Tillandsia plumosa — The Life Data

Plantae/Tracheophyta/Liliopsida/Poales/Bromeliaceae/Tillandsia

At a glance

Occurrence records120

Data sources9

Biological traits8

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Tillandsia plumosa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility120 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Occurrence & distributionGBIF120 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 50

01Narrative

Tillandsia plumosa is a species of flowering plant in the Bromeliaceae family. This species is native to Mexico.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction1

Life formepiphyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteobligatory

Growth formepiphyte

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tillandsia plumosa has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLAY614441.1 ↗2 307 bpMexico

ACGT

ATAATTATAATAAAGTGAAATATGTCGAAATCCTTTTTGGAATAATACCAAATTGAAAATAAATGTCCGATAGCAAGTTGATCAGTTAAT …

Viridantha plumosa MB-86 atpB-rbcL intergenic spacer, partial sequence; ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; and rbcL-accD intergenic spacer, partial sequence; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL3

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Tillandsia plumosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 50 n = 25

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 251×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Brown, G. K. & A. J. Gilmartin. 1989. Chromosome numbers in Bromeliaceae. Amer. J. Bot. 76(5): 657–665.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type120 records

Wild obs. + sensor28

Museum / vouchered89

Other3

Range

Area of Occupancy AOO360 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 12≤1 km 5≤10 km 5

22 georeferenced · 6 without coordinates

Open the mapobservation + sensor28

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 50≤1 km 2≤10 km 7>10 km 1

60 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence89

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	28
San Francisco, US	6
Austin, US	6
Autlán de Navarro, MX	5
Tampa, US	4
Fort Worth, US	4
Mexico City, MX	4
Durango, MX	4
Chicago, US	3
Ciudad de México, MX	3
Ann Arbor, US	2
Kew, GB	2
Saint Louis, US	2
Ciudad de México, MX	2
Austin, US	1
Claremont, US	1
Riverside, US	1
Toluca, MX	1
Mérida, MX	1
Station d'Ecologie de Lamtolocation not on record	1
University of Stellenboschlocation not on record	1
ASUlocation not on record	1
Cambridge, US	1
Chapingo, MX	1
Wayland Universitylocation not on record	1
Madison, US	1

26 institutions · 87 of 89 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Tillandsia plumosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 15.7–15.7

Seasonal swing summer↔winter9.60 °C

Max temp (day)22.0 °C

Min temp (night)9.00 °C

Precipitation34.7 mm/mo

Air humidity50.9 %

Moisture balance-93.3 mm/mo

Vapour deficit884 Pa

Wind speed4.10 m/s

Cloud cover25.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.