Tillandsia paleacea

C.Presl · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Bromeliaceae/Tillandsia

At a glance

Occurrence records332

Data sources5

Biological traits11

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Tillandsia paleacea's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility332 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF332 records

DNA & barcodingNCBIsequences

01Narrative

Tillandsia paleacea is a species in the genus Tillandsia. This species is native to Bolivia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max1 500 m

Elevation min900 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding7 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tillandsia paleacea has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences7

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLNC_081701.1 ↗155 830 bp

ACGT

ATGGCAGTTCCAAAAAAACGTACTTCTATGTCAAAAAAACGTATTCGTAGAAATATTTGGAAGAAAAAAGGATATTTAGTTGCAGTAAAA …

Tillandsia paleacea isolate T1530 voucher U:2003GR01703 chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL2

plant barcode

08Occurrence & distribution

Record type332 records

Wild obs. + sensor298

Museum / vouchered33

Cultivated / captive1

Range

Area of Occupancy AOO224 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 42≤1 km 18≤10 km 7>10 km 2

69 georeferenced · 229 without coordinates

Open the mapobservation + sensor298

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 33 records without

Open the institutions mapphysical evidence33

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	7
Chicago, US	5
Cusco, PE	4
Universiti Sains Malaysialocation not on record	3
Universidad del Valle (UniValle)location not on record	3
Bronx, US	2
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	2
Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record	1
HUT Culture Collectionlocation not on record	1
Wayland Universitylocation not on record	1
Miami, US	1
Lima, PE	1
La Paz, BO	1
Iquitos, PE	1

14 institutions · 33 of 33 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)