Tillandsia novakii — The Life Data

Plantae/Tracheophyta/Liliopsida/Poales/Bromeliaceae/Tillandsia

At a glance

Occurrence records0

Data sources4

Biological traits6

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Tillandsia novakii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

DNA & barcodingNCBIsequences

01Narrative

Tillandsia novakii is a species in the genus Tillandsia. This species is endemic to Mexico.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formepiphyte

Diet & foraging1

Parasiteindependent

Habitat & environment4

Climatewet tropical

Climberself-supporting

Epiphyteobligatory

Growth formepiphyte

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tillandsia novakii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

matKKU848415.1 ↗1 362 bpMexico

ACGT

TGATCATGGTTTAAACGATTCAATTTTTTACGAACCCGTGGAAATTATTGGTTATGACAATAAATCTAGTTCAGTACTTGTGAAACGTTT …

Tillandsia novakii isolate JP092 maturase K (matK) gene, intron and partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1

plant barcode