Tillandsia myosura

Griseb. ex Baker · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Bromeliaceae/Tillandsia

At a glance

Occurrence records83

Data sources4

Biological traits11

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Tillandsia myosura's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility83 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF83 records

DNA & barcodingNCBIsequences

01Narrative

Tillandsia myosura là một loài thuộc chi Tillandsia. Đây là loài bản địa của Bolivia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formepiphyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 600 m

Elevation min700 m

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Woodinessnon-woody

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tillandsia myosura has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLPZ270561.1 ↗156 259 bpArgentina · 2021

ACGT

TTATTTTATTATAAATAAAAAAATAAATAAAAATATTGATACATAAGATAAATACAAGAATAGATAAGACGAAATTCGTCCACCTCCCAT …

Tillandsia myosura isolate T1711 voucher MVFA:Rossado 686 chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK6★rbcL4

plant barcode

08Occurrence & distribution

Record type83 records

Wild obs. + sensor6

Museum / vouchered77

Origin

Native45

Range

Area of Occupancy AOO196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 4≤1 km 1

5 georeferenced · 1 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 2≤1 km 2≤10 km 2>10 km 1

7 georeferenced · 70 without coordinates

Open the institutions mapphysical evidence77

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Córdoba, AR	47
San Isidro, AR	11
Fundación Miguel Lillolocation not on record	5
Wlocation not on record	3
Chicago, US	2
Corrientes, AR	2
Buenos Aires, AR	1
Salta, AR	1
Dresden, DE	1
Saint Louis, US	1
South Kensington, GB	1
UNICAMPlocation not on record	1

12 institutions · 76 of 77 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)