Tillandsia bourgaei — The Life Data

Plantae/Tracheophyta/Liliopsida/Poales/Bromeliaceae/Tillandsia

At a glance

Occurrence records413

Data sources9

Biological traits8

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Tillandsia bourgaei's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility413 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Occurrence & distributionGBIF413 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 50

01Narrative

Tillandsia bourgaei is a species of flowering plant in the Bromeliaceae family. This species is endemic to Mexico.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formepiphyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteobligatory

Growth formepiphyte

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tillandsia bourgaei has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLNC_081622.1 ↗158 591 bp

ACGT

ATGGCAGTTCCAAAAAAACGTACTTCTATGTCAAAAAAACGTATTCGTAGAAATATTTGGAAGAAAAAAGGATATTTAGTTGCAGTAAAA …

Tillandsia bourgaei isolate T1122 voucher MEXU:1015 Granados Mendoza chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL2

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Tillandsia bourgaei carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 50 n = 25

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 251×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Brown, G. K. & A. J. Gilmartin. 1989. Chromosome numbers in Bromeliaceae. Amer. J. Bot. 76(5): 657–665.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type413 records

Wild obs. + sensor197

Museum / vouchered206

Other10

Range

Area of Occupancy AOO956 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 75≤1 km 58≤10 km 14>10 km 2

149 georeferenced · 48 without coordinates

Open the mapobservation + sensor197

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy97% within 1 km

≤100 m 111≤1 km 29≤10 km 4

144 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence206

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	58
Ciudad de México, MX	35
Durango, MX	25
Tampa, US	17
Austin, US	8
Ciudad de México, MX	8
Mérida, MX	8
Ann Arbor, US	7
Saint Louis, US	6
Culiacán, MX	5
Chicago, US	4
Madison, US	4
Guasave, MX	3
Toluca, MX	3
University of Stellenboschlocation not on record	3
Mexico City, MX	2
Claremont, US	2
Riverside, US	2
Bronx, US	1
Tuxtla Gutiérrez, MX	1
IPA/SPlocation not on record	1

21 institutions · 203 of 206 vouchered records shown · 2 without an institution code

09Environmental DNA1 detections

Where the DNA of Tillandsia bourgaei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 15.7–15.7

Seasonal swing summer↔winter9.60 °C

Max temp (day)22.0 °C

Min temp (night)9.00 °C

Precipitation34.7 mm/mo

Air humidity50.9 %

Moisture balance-93.3 mm/mo

Vapour deficit884 Pa

Wind speed4.10 m/s

Cloud cover25.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.