Thysanoteuthis rhombus

Troschel, 1857 · species

image placeholder — illustration coming later

Animalia/Mollusca/Cephalopoda/Oegopsida/Thysanoteuthidae/Thysanoteuthis

At a glance

Occurrence records373

Data sources12

Biological traits2

DNA specimens54

eDNA detections49

Sources12 archives

Databases and archives Thysanoteuthis rhombus's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility252 records↗

OBISOcean Biodiversity Information System121 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI49 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics54 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS373 records

Environmental DNA1 datasets · 0 countries49 detections

DNA & barcodingBOLD54 specimens

Genome at a glanceGoaT · NCBI≈2.7 Gbp

01Narrative

Thysanoteuthis rhombus, also known as the diamond squid, diamondback squid, or rhomboid squid, is a large species of squid from the family Thysanoteuthidae which is found worldwide, throughout tropical and subtropical waters. T. rhombus is given its name for the appearance of the fins that run the length of the mantle. They are a fast growing species with a lifespan of approximately 1 year. The diamond squid is the only cephalopod species known to be monogamous. T. rhombus often preys on fish and other small cephalopods at varying water depths. This species is commercially fished in Japan, specifically in the Sea of Japan and Okinawa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

05DNA & barcoding54 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Thysanoteuthis rhombus has left across the world's sequence archives.

At a glance

DNA specimens54

BINs3

Marker genes2

eDNA detections49

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P613 bp consensus50 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 54 variable positions, in barcode order

6Gmostly conserved

15Gvariable

33Gmostly conserved

42Gmostly conserved

45Gvariable

60Cmostly conserved

76Gmostly conserved

114Gmostly conserved

120Amostly conserved

126Tmostly conserved

135Amostly conserved

144Amostly conserved

162Amostly conserved

165Amostly conserved

168Amostly conserved

171Gmostly conserved

174Amostly conserved

177Amostly conserved

195Gmostly conserved

216Amostly conserved

264Amostly conserved

270Gmostly conserved

300Tmostly conserved

303Tmostly conserved

315Amostly conserved

327Gmostly conserved

333Amostly conserved

369Gmostly conserved

384Gmostly conserved

399Tmostly conserved

402Tmostly conserved

408Tmostly conserved

411Tmostly conserved

414Tmostly conserved

420Amostly conserved

423Amostly conserved

432Cmostly conserved

433Tmostly conserved

460Gmostly conserved

492Cmostly conserved

501Amostly conserved

507Amostly conserved

513Amostly conserved

522Tmostly conserved

531Amostly conserved

534Amostly conserved

555Cmostly conserved

558Cmostly conserved

570Cmostly conserved

579Tmostly conserved

582Gmostly conserved

585Gvariable

591Tmostly conserved

597Gmostly conserved

TCCTTGAGCCTTATGATTCGAACCGAACTTGGGCAACCAGGGTCGCTTCTCAATGACGACCAACTATATAACGTAGTTGTTACCGCTCAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 45 variants.

Diversity (π)2.6%

Haplotypes45

BINs3

Most divergent pair16.6%

AsiaOtherEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Teuthowenia megalopssame order16.5%Moroteuthopsis ingenssame order17.2%Onykia loennbergiisame order17.5%Filippovia knipovitchisame order17.5%Moroteuthopsis longimanasame order17.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_058301 ↗ · 18 protein · 23 tRNA · 2 rRNA

COX3ND2COX1COX2ATP8ATP6ND5ND4ND4LCYTBND6ND1ND316S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Thysanoteuthis rhombus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈2 735 858 501 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Thysanoteuthis rhombus2.74 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness80.1% BUSCO

08Occurrence & distribution

Record type373 records

Wild obs. + sensor165

Museum / vouchered205

Other3

Origin

Native2

Range

Area of Occupancy AOO944 km²

Depth

0–200 m sunlit68

200–1000 m twilight13

1–4 km midnight1

>4 km abyssal0

median 50 m · max 2 603.5 m · 82 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy45% within 1 km

≤100 m 23≤1 km 19≤10 km 11>10 km 41

94 georeferenced · 71 without coordinates

Open the mapobservation + sensor165

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 2≤1 km 8≤10 km 4>10 km 6

20 georeferenced · 185 without coordinates

Open the institutions mapphysical evidence205

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	61
UM-RSMASlocation not on record	9
Museums Victorialocation not on record	9
National Marine Biodiversity Institute of Korealocation not on record	6
Santa Barbara Museum of Natural Historylocation not on record	5
Cambridge, US	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
ICM-CSIClocation not on record	2
The Atlantic reference Centrelocation not on record	2
Texas Cooperative Wildlife Collectionlocation not on record	2
Sydney, AU	2
Earth Sciences New Zealandlocation not on record	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
Natick, US	1
North Carolina Museum of Natural Scienceslocation not on record	1
Puerto Ayora, EC	1
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	1
ELMClocation not on record	1
Bando, JP	1
Delaware Museum of Nature and Sciencelocation not on record	1
Western Australian Museumlocation not on record	1
Tasmanian Museum & Art Gallerylocation not on record	1
Chicago, US	1

23 institutions · 114 of 205 vouchered records shown · 1 without an institution code

09Environmental DNA49 detections

Where the DNA of Thysanoteuthis rhombus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found49

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 49 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)