Thyone fusus
(O.F.Müller, 1776) · speciesAt a glance
Occurrence records6 032
Data sources7
Biological traits4
DNA specimens9
eDNA detections8
Sources7 archives
Databases and archives Thyone fusus's data was compiled from.
WikipediaWikimedia Foundation3 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility3 164 records↗
OBISOcean Biodiversity Information System2 868 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics9 specimens↗
Open Tree of LifeOpenTreephylogeny backbone↗On this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements1 literature sources4 traits
Occurrence & distributionGBIF · OBIS6 032 records
Environmental DNA1 datasets · 2 countries8 detections
DNA & barcodingBOLD9 specimens
01Narrative
Thyone fusus is a species of sea cucumber in the family Phyllophoridae. It is found on the seabed in the northeastern Atlantic Ocean and the Mediterranean Sea. It is a suspension feeder and catches food particles floating past with its branching feeding tentacles.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesSeaLifeBase
Habitat & environment2
Habitat saltwateryes
Habitat zonebenthic
Other traits2
Depth max150 m
Depth min20 m
05DNA & barcoding9 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Thyone fusus has left across the world's sequence archives.
At a glance
DNA specimens9
BINs2
Marker genes1
eDNA detections8
Countries4
The DNA barcodethe species' typical barcode, built from every sequenced specimen
COI-5P637 bp consensus5 specimens
ACGT
▸ drag or hover over the strip to read any position — letter and how much it varies
Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 79% of positions are identical in every specimen.
Where individuals differ — all 131 variable positions, in barcode order
1Tmostly conserved
2Amostly conserved
4Amostly conserved
13Cmostly conserved
14Amostly conserved
16Gmostly conserved
17Gmostly conserved
18Cmostly conserved
28Amostly conserved
37Amostly conserved
40Tmostly conserved
43Amostly conserved
53Cmostly conserved
55Cmostly conserved
67Amostly conserved
70Cmostly conserved
73Tvariable
76Amostly conserved
82Cmostly conserved
91Amostly conserved
94Cmostly conserved
100Cvariable
101Gmostly conserved
106Tmostly conserved
109Amostly conserved
112Cmostly conserved
118Cmostly conserved
119Tmostly conserved
122Amostly conserved
130Cmostly conserved
133Tmostly conserved
142Amostly conserved
148Amostly conserved
160Amostly conserved
163Amostly conserved
176Cmostly conserved
179Gmostly conserved
181Amostly conserved
184Amostly conserved
193Tmostly conserved
196Amostly conserved
199Cmostly conserved
205Cmostly conserved
226Avariable
229Tmostly conserved
230Cmostly conserved
232Tmostly conserved
244Cmostly conserved
245Amostly conserved
250Tmostly conserved
253Cmostly conserved
256Amostly conserved
262Cmostly conserved
263Cmostly conserved
265Cmostly conserved
268Amostly conserved
272Amostly conserved
274Tvariable
283Tmostly conserved
284Gmostly conserved
292Cvariable
295Tmostly conserved
297Cmostly conserved
304Amostly conserved
319Tmostly conserved
322Tmostly conserved
325Tmostly conserved
334Gmostly conserved
349Amostly conserved
353Amostly conserved
355Tmostly conserved
358Tmostly conserved
365Cmostly conserved
367Cmostly conserved
380Tmostly conserved
382Amostly conserved
394Amostly conserved
400Cmostly conserved
403Tmostly conserved
406Amostly conserved
427Tmostly conserved
430Gmostly conserved
436Cmostly conserved
437Tmostly conserved
439Cmostly conserved
442Tmostly conserved
448Cmostly conserved
449Gmostly conserved
451Cmostly conserved
460Cmostly conserved
461Tmostly conserved
462Cmostly conserved
473Cmostly conserved
475Cmostly conserved
479Tmostly conserved
481Amostly conserved
485Gmostly conserved
487Cmostly conserved
493Cmostly conserved
494Amostly conserved
497Cmostly conserved
500Cmostly conserved
502Cmostly conserved
505Amostly conserved
506Amostly conserved
508Amostly conserved
509Amostly conserved
520Tmostly conserved
523Tmostly conserved
526Tmostly conserved
527Cmostly conserved
532Cmostly conserved
535Gmostly conserved
538Amostly conserved
541Amostly conserved
544Amostly conserved
547Cmostly conserved
553Tmostly conserved
557Cmostly conserved
559Cvariable
+11 more variable positions not shown
TACATGAGCAGGCATGGCAGGAACAGCAATGAGAGTAATTATACGAACAGAACTCGCCCAACCAGGATCCCTTCTACAAGACGACCAAAT …
Variant network
Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.
Diversity (π)8.6%
Haplotypes4
BINs2
Most divergent pair19.9%
OtherEurope
Closest relatives by DNA barcode
The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P
animal barcode
08Occurrence & distribution
Record type6 032 records
Wild obs. + sensor1 853
Museum / vouchered3 349
Other830
Origin
Native9
Range
Area of Occupancy AOO5 900 km²
Depth
0–200 m sunlit1 281
200–1000 m twilight26
1–4 km midnight1
>4 km abyssal0
median 30 m · max 1 229 m · 1 308 records with depth
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy97% within 1 km
≤100 m 1 585≤1 km 48≤10 km 53>10 km 1
1 687 georeferenced · 166 without coordinates
Open the mapobservation + sensor1 853
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy78% within 1 km
≤100 m 228≤1 km 104≤10 km 92>10 km 4
428 georeferenced · 2 921 without coordinates
Open the institutions mapphysical evidence3 349
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions9 of 34 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| CEFASlocation not on record | 484 |
| Institut Francais pour l'Etude de la Merlocation not on record | 211 |
| 486location not on record | 113 |
| Gothenburg, SE | 104 |
| SLU Artdatabankenlocation not on record | 93 |
| Bergen, NO | 46 |
| University of Oslo (UiO)location not on record | 28 |
| DASSHlocation not on record | 23 |
| Laboratoria di biologia marina di Triestelocation not on record | 17 |
| NTNU-VMlocation not on record | 13 |
| 730location not on record | 7 |
| Cambridge, US | 6 |
| Stockholm, SE | 6 |
| Université de Liège Underwater research and oceanographic station (4501)location not on record | 4 |
| AUTHlocation not on record | 4 |
| Bergen, NO | 4 |
| Washington, US | 3 |
| Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Université de Liège Underwater research and oceanographic station (4501)location not on record | 3 |
| MZLUlocation not on record | 3 |
| RWSlocation not on record | 2 |
| PNHSlocation not on record | 2 |
| South Kensington, GB | 2 |
| Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Phaxas Expertise Of Marine Fauna (4507) Université de Liège Underwater research and oceanographic station (4501)location not on record | 1 |
| The Atlantic Reference Centre (ARC)location not on record | 1 |
| Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record | 1 |
| Natural History Museum, Londonlocation not on record | 1 |
| Station Biologique de Roscoff (EDMO:521)location not on record | 1 |
| CSIC-CEAB Centre for Advanced Studies of Blanes (1393) Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Phaxas Expertise Of Marine Fauna (4507) Université de Liège Underwater research and oceanographic station (4501)location not on record | 1 |
| CSIC-CEAB Centre for Advanced Studies of Blanes (1393)location not on record | 1 |
| CSIC-CEAB Centre for Advanced Studies of Blanes (1393) Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Université de Liège Underwater research and oceanographic station (4501)location not on record | 1 |
| Observatoire Océanologique de Banyuls-Sur-Mer; Laboratoire d'Océanographie Biologiquelocation not on record | 1 |
| Brussels, BE | 1 |
| Paris, FR | 1 |
| RBINS-Scientific Heritagelocation not on record | 1 |
34 institutions · 1 190 of 3 349 vouchered records shown · 69 without an institution code
09Environmental DNA8 detections
Where the DNA of Thyone fusus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found8
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 8 detections have coordinates
Open the map2 countries0
Mixed hard bottomStone, gravel, clayRock, gravel and sandBoulders and clay
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median10.2 °C 3.60–16.9
Seasonal swing summer↔winter15.6 °C
Max temp (day)11.8 °C 4.70–18.2
Min temp (night)7.80 °C 1.40–15.5
Precipitation78.0 mm/mo 60.7–183
Air humidity62.2 % 60.9–64.1
Vapour deficit479 Pa 313–735
Cloud cover52.3 % 47.4–55.5
CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.