Thunnus obesus

(Lowe, 1839) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Scombridae/Thunnus

At a glance

Occurrence records196 296

Data sources15

Biological traits9

DNA specimens186

eDNA detections183

Sources15 archives

Databases and archives Thunnus obesus's data was compiled from.

WikipediaWikimedia Foundation16 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility73 541 records↗

OBISOcean Biodiversity Information System122 755 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI183 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics186 specimens↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements2 literature sources9 traits

Chemical compositionNPASS13 compounds

Occurrence & distributionGBIF · OBIS196 296 records

Environmental DNA3 datasets · 4 countries183 detections

DNA & barcodingBOLD186 specimens

Genome at a glanceGoaT · NCBI≈839 Mbp

01Narrative

The bigeye tuna (Thunnus obesus) is a species of true tuna of the genus Thunnus, belonging to the wider mackerel family Scombridae. In Hawaiian, it is one of two species known as ahi, the other being the yellowfin tuna.[1] Bigeye tuna are found in the open waters of all tropical and temperate oceans, but not in the Mediterranean Sea.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAnAgeFishBase

Size & morphology2

Body length250 cm

Body mass115 500 g

⚠ sources differ — AnAge: 115 500 g · FishBase: 210 000 g

Life cycle & reproduction1

Max. longevity132 months

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic-oceanic

Uses & economy1

Commercial importancehighly commercial

Other traits3

Depth max1 500 m

Depth min0 m

Vulnerability55.53

03Chemical composition13 compounds

Compounds documented for Thunnus obesus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Guaiane sesquiterpenoids10

Germacrane sesquiterpenoids1

Documented compounds13 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,2S,3S,5R,8E,11S,14S)-2-hydroxy-5,9,14-trimethyl-4,12-dioxatricyclo[9.3.0.03,5]tetradec-8-en-13-one	present	NPASS
(1S,5S,6R,9S,10S,11R)-2,6,11-trimethyl-8,12,13-trioxatetracyclo[9.2.2.01,10.05,9]pentadeca-2,14-dien-7-one	present	NPASS
(1S,5S,9S,10S,11R)-2,11-dimethyl-6-methylidene-8,12,13-trioxatetracyclo[9.2.2.01,10.05,9]pentadeca-2,14-dien-7-one	present	NPASS
(2S)-2-[(5R)-3,8-dimethyl-5,6-dihydroazulen-5-yl]propanoic acid	present	NPASS
(3aS,5R,9S,9aS,9bS)-9-hydroperoxy-5-methoxy-6,9-dimethyl-3-methylidene-4,5,9a,9b-tetrahydro-3aH-azuleno[4,5-b]furan-2-one	present	NPASS
(3aS,6aS,9aR,9bS)-6a-hydroperoxy-6,9-dimethyl-3-methylidene-4,7,9a,9b-tetrahydro-3aH-azuleno[4,5-b]furan-2-one	present	NPASS
(3aS,9aS,9bS)-6-methyl-3,9-dimethylidene-4,5,9a,9b-tetrahydro-3aH-azuleno[4,5-b]furan-2-one	present	NPASS
(3R,3aS,6S,6aS,9S,9aS,9bS)-6,9-dihydroxy-6a-methoxy-3,6,9-trimethyl-3,3a,4,5,9a,9b-hexahydroazuleno[4,5-b]furan-2-one	present	NPASS
(3R,3aS,9bR)-3,6,9-trimethyl-3a,4,5,9b-tetrahydro-3H-azuleno[4,5-b]furan-2-one	present	NPASS
2-[(5R)-3,8-dimethyl-5,6-dihydroazulen-5-yl]prop-2-enoic acid	present	NPASS

05DNA & barcoding186 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Thunnus obesus has left across the world's sequence archives.

At a glance

DNA specimens186

BINs1

Marker genes13

eDNA detections183

Countries16

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus122 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

3Cmostly conserved

15Cmostly conserved

27Tmostly conserved

28Gmostly conserved

30Amostly conserved

39Cmostly conserved

40Amostly conserved

41Cmostly conserved

42Gmostly conserved

44Cmostly conserved

65Cmostly conserved

66Tmostly conserved

67Gmostly conserved

74Gmostly conserved

79Cmostly conserved

285Tvariable

384Amostly conserved

399Gmostly conserved

CTCTATCTAGTATTCGGTGCATGAGCTGGAATAGTTGGCACGGCCTTAAGCTTGCTCATCCGAGCTGAACTAAGCCAACCAGGTGCCCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes15

BIN1

Most divergent pair1.7%

OceaniaAfricaOtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Thunnus alalungasame genus1.5%Thunnus orientalissame genus1.7%Euthynnus alletteratussame family8.3%Auxis rocheisame family8.6%Euthynnus lineatussame family8.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5Patp6COIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6D-loop

animal barcodemitochondrialmarker

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_014059 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Thunnus obesus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈839 276 673 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Thunnus obesus0.84 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

07Deep time~1.29 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin1.29 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

How it livedPBDB

Motilityactively mobile

Compositionhydroxyapatite

08Occurrence & distribution

Record type196 296 records

Wild obs. + sensor142 013

Museum / vouchered357

Cultivated / captive2

Other53 924

Origin

Native1

Range

Area of Occupancy AOO171 240 km²

Depth

0–200 m sunlit44 011

200–1000 m twilight10 720

1–4 km midnight5 121

>4 km abyssal126

median 59.6 m · max 4 905 m · 59 978 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy44% within 1 km

≤100 m 1 275≤1 km 164≤10 km 150>10 km 1 674

3 263 georeferenced · 138 750 without coordinates

Open the mapobservation + sensor142 013

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 38≤1 km 22≤10 km 20>10 km 16

96 georeferenced · 261 without coordinates

Open the institutions mapphysical evidence357

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SEAOBISlocation not on record	32
Washington, US	26
IEOCAlocation not on record	20
Sydney, AU	19
Australian National Fish Collectionlocation not on record	18
Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record	17
University of California San Diegolocation not on record	6
Kagoshima University Museumlocation not on record	5
National Fisheries Research and Development Institutelocation not on record	4
Stockholm, SE	3
Museum national d'Histoire naturellelocation not on record	3
Dalhousie Universitylocation not on record	3
Paris, FR	3
DASSHlocation not on record	3
Toronto, CA	2
Museu Nacional de História Natural e da Ciêncialocation not on record	2
Natick, US	1
Vancouver, CA	1
Los Angeles, US	1
Chicago, US	1

20 institutions · 170 of 357 vouchered records shown · 35 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA183 detections

Where the DNA of Thunnus obesus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found183

Studies independent surveys3

Countries4

Verifiable raw sequence linked119

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 183 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.5 °C -0.9–19.1

Seasonal swing summer↔winter22.7 °C

Max temp (day)12.8 °C 2.00–23.2

Min temp (night)7.80 °C -4.90–16.4

Precipitation112 mm/mo 89.3–146

Air humidity61.5 % 59.9–65.9

Moisture balance47.2 mm/mo -42.2–91.8

Vapour deficit492 Pa 230–824

Wind speed4.90 m/s 3.80–6.80

Cloud cover51.3 % 45.8–63.2

CHELSA 1981–2010, ~9 km grid, at location & month of 177 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Thunnus obesus

At a glance

Sources15 archives

Size & morphology2

Life cycle & reproduction1

Habitat & environment2

Uses & economy1

Other traits3

Compound class profile2 classes

Documented compounds13 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

At a glance

When this lineage existed

How it livedPBDB

Record type196 296 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 20 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type196 296 records