Thunnus maccoyii

(Castelnau, 1872) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Scombridae/Thunnus

At a glance

Occurrence records4 225

Data sources13

Biological traits11

DNA specimens44

eDNA detections116

Sources13 archives

Databases and archives Thunnus maccoyii's data was compiled from.

WikipediaWikimedia Foundation14 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 982 records↗

OBISOcean Biodiversity Information System2 243 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI116 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics44 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources11 traits

Occurrence & distributionGBIF · OBIS4 225 records

Environmental DNA2 datasets · 1 countries116 detections

DNA & barcodingBOLD44 specimens

Genome at a glanceGoaT · NCBI≈782 Mbp

01Narrative

The southern bluefin tuna (Thunnus maccoyii) is a tuna of the family Scombridae found in open southern Hemisphere waters of all the world's oceans mainly between 30°S and 50°S, to nearly 60°S. At up to 2.5 m and weighing up to 260 kg, it is among the larger bony fishes. Southern bluefin tuna, like other pelagic tuna species, are part of a group of bony fishes that can maintain their body core temperature up to 10 C-change above the ambient temperature. This advantage enables them to maintain high metabolic output for predation and migrating large distances. The southern bluefin tuna is an opportunistic feeder, preying on a wide variety of fish, crustaceans, cephalopods, salps, and other marine animals.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAnAgeFishBase

Size & morphology2

Body length245 cm

Body mass143 000 g

⚠ sources differ — AnAge: 143 000 g · FishBase: 260 000 g

Life cycle & reproduction3

Age at maturity (male)3 102 days

Age at sexual maturity3 102 days

Max. longevity240 months

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic-oceanic

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max2 743 m

Depth min0 m

Vulnerability66.9

05DNA & barcoding44 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Thunnus maccoyii has left across the world's sequence archives.

At a glance

DNA specimens44

BINs1

Marker genes13

eDNA detections116

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P642 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

4Cmostly conserved

484Gmostly conserved

508Gmostly conserved

CCTCTATCTAGTATTCGGTGCATGAGCTGGAATAGTTGGCACGGCCTTAAGCTTGCTCATCCGAGCTGAACTAAGCCAACCAGGTGCCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.23%

Haplotypes6

BIN1

Most divergent pair0.62%

AsiaOceaniaOtherN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euthynnus alletteratussame family8.7%Euthynnus lineatussame family8.9%Auxis rocheisame family8.9%Euthynnus affinissame family9.0%Auxis thazardsame family9.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5Patp6COIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6D-loop

animal barcodemitochondrialmarker

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_014101 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBs-rRNAl-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Thunnus maccoyii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈782 407 452 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Thunnus maccoyii0.78 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.1% BUSCO

07Deep time~3.62 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin3.62 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

How it livedPBDB

Motilityactively mobile

Compositionhydroxyapatite

08Occurrence & distribution

Record type4 225 records

Wild obs. + sensor3 979

Museum / vouchered239

Other7

Origin

Native103

Range

Area of Occupancy AOO2 596 km²

Depth

0–200 m sunlit1 752

200–1000 m twilight2

1–4 km midnight1

>4 km abyssal0

median 1 m · max 2 743.2 m · 1 755 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 1 600≤1 km 1 933≤10 km 44>10 km 376

3 953 georeferenced · 26 without coordinates

Open the mapobservation + sensor3 979

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 14≤1 km 34≤10 km 10>10 km 11

69 georeferenced · 170 without coordinates

Open the institutions mapphysical evidence239

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	18
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	11
SEAOBISlocation not on record	8
Museums Victorialocation not on record	6
Western Australian Museumlocation not on record	4
Sydney, AU	3
Natick, US	2
Washington, US	2
QVMAGlocation not on record	2

9 institutions · 56 of 239 vouchered records shown · 62 without an institution code

09Environmental DNA116 detections

Where the DNA of Thunnus maccoyii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found116

Studies independent surveys2

Countries1

Verifiable raw sequence linked113

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 116 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.60 °C -2.80–19.1

Seasonal swing summer↔winter26.4 °C

Max temp (day)12.6 °C 0.9–23.2

Min temp (night)7.80 °C -6.10–16.4

Precipitation106 mm/mo 89.3–129

Air humidity61.5 % 58.7–65.7

Moisture balance12.5 mm/mo -48.3–89.6

Vapour deficit457 Pa 197–824

Wind speed4.70 m/s 3.90–5.70

Cloud cover51.7 % 45.8–63.5

CHELSA 1981–2010, ~9 km grid, at location & month of 113 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Thunnus maccoyii

At a glance

Sources13 archives

Size & morphology2

Life cycle & reproduction3

Habitat & environment2

Uses & economy1

Other traits3

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

At a glance

When this lineage existed

How it livedPBDB

Record type4 225 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 225 records