Thunnus albacares

(Bonnaterre, 1788) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Scombridae/Thunnus

At a glance

Occurrence records419 631

Data sources14

Biological traits10

DNA specimens769

eDNA detections142

Sources14 archives

Databases and archives Thunnus albacares's data was compiled from.

WikipediaWikimedia Foundation19 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility173 167 records↗

OBISOcean Biodiversity Information System246 464 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI142 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics769 specimens↗

FooDBThe Metabolomics Innovation Centrecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources10 traits

Chemical compositionFooDB61 compounds

Occurrence & distributionGBIF · OBIS419 631 records

Environmental DNA1 datasets · 5 countries142 detections

DNA & barcodingBOLD769 specimens

Genome at a glanceGoaT · NCBI880 Mbp

01Narrative

The yellowfin tuna (Thunnus albacares) is a species of tuna found in pelagic waters of tropical and subtropical oceans worldwide. Yellowfin is often marketed as ahi, from the Hawaiian , a name also used there for the closely related bigeye tuna. The species name, albacares ("white meat") can also lead to confusion: in English, the albacore (Thunnus alalunga) is a different species, while yellowfin is officially designated albacore in French and referred to as albacora by Portuguese fishermen.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAnAgeFishBase

Size & morphology2

Body length239 cm

Body mass200 000 g

Life cycle & reproduction1

Max. longevity108 months

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonepelagic-oceanic

Uses & economy1

Commercial importancehighly commercial

Other traits3

Depth max1 602 m

Depth min1 m

Vulnerability45.6

03Chemical composition61 compounds

Compounds documented for Thunnus albacares across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cookingAquatic foods

Compound class profile5 classes

Aminoacids28

Branched fatty acids $ Unsaturated fatty acids9

Prenol lipids6

Pyridine alkaloids6

pteridine alkaloids5

Documented compounds61 total

Tissue Source Quantified only

Compound	Amount	Source
L-Glutamic acid	4,168 mg/100g	FooDB
L-Aspartic acid	2,860 mg/100g	FooDB
epsilon-Polylysine	2,565 mg/100g	FooDB
L-Leucine	2,270 mg/100g	FooDB
L-Alanine	1,689 mg/100g	FooDB
Arginine	1,671 mg/100g	FooDB

05DNA & barcoding769 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Thunnus albacares has left across the world's sequence archives.

At a glance

DNA specimens769

BINs2

Marker genes14

eDNA detections142

Countries29

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P500 bp consensus683 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

185Tmostly conserved

200Cmostly conserved

TAGTAATACCAATTATGATTGGAGGATTTGGAAACTGACTTATTCCTCTAATGATCGGAGCCCCCGACATGGCATTCCCACGAATGAACA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 41 variants.

Diversity (π)0.43%

Haplotypes41

BINs2

Most divergent pair19.8%

AfricaS.AmericaEuropeAsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Thunnus alalungasame genus1.6%Thunnus orientalissame genus1.8%Euthynnus alletteratussame family10.3%Sarda sardasame family10.4%Auxis rocheisame family10.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5Patp6COIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6D-loop

animal barcodemitochondrialmarker

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_014061 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBs-rRNAl-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Thunnus albacares carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size880 200 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Thunnus albacares0.88 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.3% BUSCO

07Deep time~1.29 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin1.29 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

How it livedPBDB

Motilityactively mobile

Compositionhydroxyapatite

08Occurrence & distribution

Record type419 631 records

Wild obs. + sensor341 653

Museum / vouchered1 154

Other76 824

Origin

Native9

Range

Area of Occupancy AOO285 724 km²

Depth

0–200 m sunlit100 716

200–1000 m twilight27 536

1–4 km midnight14 081

>4 km abyssal165

median 78.3 m · max 4 700 m · 142 498 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 22 974≤1 km 2 707≤10 km 2 024>10 km 5 739

33 444 georeferenced · 308 209 without coordinates

Open the mapobservation + sensor341 653

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 54≤1 km 21≤10 km 78>10 km 41

194 georeferenced · 960 without coordinates

Open the institutions mapphysical evidence1 154

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 45 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	84
Sydney, AU	58
National Fisheries Research and Development Institutelocation not on record	43
SEAOBISlocation not on record	31
Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record	25
University of California San Diegolocation not on record	21
Australian National Fish Collectionlocation not on record	16
Universidad Católica del Nortelocation not on record	9
Kagoshima University Museumlocation not on record	9
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	8
Los Angeles, US	8
South African Institute for Aquatic Biodiversitylocation not on record	7
CASlocation not on record	7
Cambridge, US	6
Wuzhou, CN	6
No Voucherlocation not on record	5
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	5
Museum national d'Histoire naturellelocation not on record	5
Instituto de Investigaciones Marinas y Costeras José Benito Vives de Andréis (INVEMAR)location not on record	4
Vancouver, CA	4
Paris, FR	4
North Carolina Museum of Natural Scienceslocation not on record	4
Museu Nacional de História Natural e da Ciêncialocation not on record	4
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	3
Centro Interdisciplinario de Ciencias Marinas, Instituto Politécnico Nacionallocation not on record	3
FishBaselocation not on record	3
Natick, US	3
Tapachula, MX	3
UWFClocation not on record	2
Chicago, US	2
DASSHlocation not on record	2
Western Australian Museumlocation not on record	2
University of Victorialocation not on record	2
University of Texas Biodiversity Collections (UTBC)location not on record	2
Auckland, NZ	2
Oregon State Universitylocation not on record	1
Puerto Ayora, EC	1
Centre for Biodiversity Genomics, Informatics Departmentlocation not on record	1
El Colegio de la Frontera Sur, Unidad Chetumallocation not on record	1
Criobelocation not on record	1
Stockholm, SE	1
University of Nebraskalocation not on record	1
Southwest Fisheries Science Centerlocation not on record	1
Chinese Academy of Sciences, Institute of Oceanologylocation not on record	1
Ann Arbor, US	1

45 institutions · 412 of 1 154 vouchered records shown · 164 without an institution code

09Environmental DNA142 detections

Where the DNA of Thunnus albacares was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found142

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 142 detections have coordinates

Open the map5 countries0

Food

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.2 °C 11.3–27.2

Seasonal swing summer↔winter2.60 °C

Max temp (day)28.8 °C 15.1–28.8

Min temp (night)25.2 °C 7.30–25.2

Precipitation264 mm/mo 77.1–264

Air humidity65.7 % 62.5–65.7

Vapour deficit1,231 Pa 552–1,231

Cloud cover63.0 % 41.8–63.0

CHELSA 1981–2010, ~9 km grid, at location & month of 52 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Thunnus albacares

At a glance

Sources14 archives

Size & morphology2

Life cycle & reproduction1

Habitat & environment3

Uses & economy1

Other traits3

Compound class profile5 classes

Documented compounds61 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

At a glance

When this lineage existed

How it livedPBDB

Record type419 631 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 45 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type419 631 records