Thrips tabaci

Lindeman, 1889 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Thysanoptera/Thripidae/Thrips

At a glance

Occurrence records3 475

Data sources10

Biological traits0

DNA specimens1 340

eDNA detections516

Sources10 archives

Databases and archives Thrips tabaci's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 475 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI516 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 340 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 475 records

Environmental DNA5 datasets · 26 countries516 detections

DNA & barcodingBOLD1 340 specimens

Genome at a glanceGoaT · NCBI396 Mbp

01Narrative

Thrips tabaci is a species of very small insect in the genus Thrips in the order Thysanoptera. It is commonly known as the onion thrips, the potato thrips, the tobacco thrips or the cotton seedling thrips. It is an agricultural pest that can damage crops of onions and other plants, and it can additionally act as a vector for plant viruses.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 340 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Thrips tabaci has left across the world's sequence archives.

At a glance

DNA specimens1 340

BINs12

Marker genes4

eDNA detections516

Countries45

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus1 062 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 80 variable positions, in barcode order

1Cmostly conserved

4Tmostly conserved

5Amostly conserved

6Cmostly conserved

8Tmostly conserved

10Amostly conserved

12Tmostly conserved

13Tmostly conserved

16Gmostly conserved

17Gmostly conserved

18Amostly conserved

19Tmostly conserved

20Tmostly conserved

21Tmostly conserved

23Gmostly conserved

24Gmostly conserved

26Cmostly conserved

27Amostly conserved

28Gmostly conserved

29Gmostly conserved

31Amostly conserved

32Tmostly conserved

33Gmostly conserved

36Amostly conserved

37Gmostly conserved

38Gmostly conserved

39Gmostly conserved

40Cmostly conserved

41Tmostly conserved

42Tmostly conserved

43Tmostly conserved

44Cmostly conserved

47Tmostly conserved

48Amostly conserved

49Amostly conserved

50Gmostly conserved

53Tmostly conserved

57Tmostly conserved

61Cmostly conserved

62Gmostly conserved

63Amostly conserved

64Tmostly conserved

65Tmostly conserved

67Amostly conserved

68Amostly conserved

69Tmostly conserved

70Tmostly conserved

71Tmostly conserved

72Amostly conserved

73Cmostly conserved

74Gmostly conserved

76Amostly conserved

77Cmostly conserved

79Tmostly conserved

94Amostly conserved

99Amostly conserved

129Gmostly conserved

153Tmostly conserved

198Gvariable

312Amostly conserved

321Gvariable

333Amostly conserved

351Gmostly conserved

408Gmostly conserved

423Amostly conserved

480Amostly conserved

522Cmostly conserved

528Tmostly conserved

541Tmostly conserved

543Gvariable

555Gmostly conserved

588Cmostly conserved

594Tmostly conserved

597Cmostly conserved

615Amostly conserved

618Avariable

624Gmostly conserved

633Tmostly conserved

639Tmostly conserved

651Tmostly conserved

CTTTACTTCATTTTTGGATTTTGGTCAGGAATGATAGGGCTTTCTTTAAGAATAATTATTCGATTAAATTTACGAACATCAATAAAACTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 44 variants.

Diversity (π)3.2%

Haplotypes44

BINs11

Most divergent pair8.0%

N.AmericaAsiaOceaniaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Thrips minutissimussame genus15.4%Lefroyothrips lefroyisame family15.4%Thrips hawaiiensissame genus15.7%Thrips bourbonensissame genus16.1%Chirothrips hamatussame family16.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS216S

animal barcodefungal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Thrips tabaci carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size396 090 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Thrips tabaci0.40 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type3 475 records

Wild obs. + sensor599

Museum / vouchered2 866

Other10

Origin

Native1

Range

Area of Occupancy AOO3 372 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 26≤1 km 519≤10 km 26>10 km 15

586 georeferenced · 13 without coordinates

Open the mapobservation + sensor599

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 129≤1 km 469≤10 km 265

863 georeferenced · 2 003 without coordinates

Open the institutions mapphysical evidence2 866

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	688
MWLRlocation not on record	394
Mexico City, MX	344
University of Alberta Museums (UAM)location not on record	283
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	171
New Zealand Arthropod Collectionlocation not on record	171
MZLUlocation not on record	79
University of Guelph, Centre for Biodiversity Genomicslocation not on record	76
NTNU-VMlocation not on record	44
SLU Artdatabankenlocation not on record	35
Norwegian Institute of Bioeconomy Researchlocation not on record	34
Edmonton, CA	31
Helsinki, FI	19
Stockholm, SE	18
US	5
Provo, US	4
Natick, US	2
Washington, US	1
Kuopio, FI	1
Auckland, NZ	1
Sydney, AU	1
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	1
YAU5082020location not on record	1
ULLlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
Champaign, US	1
Tasmanian Museum & Art Gallerylocation not on record	1

27 institutions · 2 408 of 2 866 vouchered records shown · 413 without an institution code

09Environmental DNA516 detections

Where the DNA of Thrips tabaci was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found516

Studies independent surveys5

Countries26

Verifiable raw sequence linked105

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 516 detections have coordinates

Open the map26 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 11.0–20.4

Seasonal swing summer↔winter16.9 °C

Max temp (day)19.7 °C 14.4–24.0

Min temp (night)12.0 °C 6.70–16.0

Precipitation65.0 mm/mo 30.7–109

Air humidity59.3 % 56.0–63.4

Moisture balance-26.8 mm/mo -89.7–13.3

Vapour deficit725 Pa 521–1,002

Wind speed3.70 m/s 2.40–5.30

Cloud cover42.4 % 29.8–50.9

CHELSA 1981–2010, ~9 km grid, at location & month of 350 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Thrips tabaci

At a glance

Sources10 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type3 475 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 475 records