Thorogobius ephippiatus

(Lowe, 1839) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Gobiidae/Thorogobius

At a glance

Occurrence records10 073

Data sources13

Biological traits7

DNA specimens6

eDNA detections5

Sources13 archives

Databases and archives Thorogobius ephippiatus's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 863 records↗

OBISOcean Biodiversity Information System4 210 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Occurrence & distributionGBIF · OBIS10 073 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD6 specimens

Genome at a glanceGoaT · NCBI≈1 Gbp

01Narrative

Thorogobius ephippiatus, the leopard-spotted goby, is a species of goby native to the eastern Atlantic Ocean and the Mediterranean Sea.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAnAgeFishBase

Size & morphology1

Body length13 cm

Life cycle & reproduction1

Max. longevity108 months

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits3

Depth max40 m

Depth min6 m

Vulnerability36.08

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Thorogobius ephippiatus has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections5

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.60%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 11 variable positions, in barcode order

13Gmostly conserved

34Amostly conserved

43Cmostly conserved

124Cmostly conserved

142Amostly conserved

283Avariable

394Cmostly conserved

421Gmostly conserved

454Tmostly conserved

508Amostly conserved

535Cmostly conserved

CCTATACCTCGTGTTTGGTGCCTGGGCCGGGATACTCGGAACCGGCCTGAGCCTATTGATTCGAACAGAGCTGGGTCAACCCGGGGCTCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gobius auratussame family17.1%Parabembras curtussame order17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Thorogobius ephippiatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 018 328 219 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Thorogobius ephippiatus1.02 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type10 073 records

Wild obs. + sensor5 738

Museum / vouchered4 066

Other269

Origin

Native6

Range

Area of Occupancy AOO7 368 km²

Depth

0–200 m sunlit3 570

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 14.8 m · max 100 m · 3 570 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 4 669≤1 km 350≤10 km 74>10 km 7

5 100 georeferenced · 638 without coordinates

Open the mapobservation + sensor5 738

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 12≤1 km 7≤10 km 11>10 km 3

33 georeferenced · 4 033 without coordinates

Open the institutions mapphysical evidence4 066

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DASSHlocation not on record	12
PNHSlocation not on record	6
Citadel Hill, GB	5
Frankfurt am Main	3
National Museum of the Czech Republiclocation not on record	2
	2
Copenhagen, DK	2
Bergen, NO	1
Stockholm, SE	1
Paris, FR	1
Moore Laboratory of Zoology, Occidental Collegelocation not on record	1
Barcelona, ES	1
SNSB-Zoologische Staatssammlung Münchenlocation not on record	1
Louisiana State University, Museum of Zoologylocation not on record	1

14 institutions · 39 of 4 066 vouchered records shown · 4 without an institution code

09Environmental DNA5 detections

Where the DNA of Thorogobius ephippiatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

Bottom

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.4 °C 12.4–13.3

Seasonal swing summer↔winter14.6 °C

Max temp (day)14.2 °C 14.2–15.6

Min temp (night)9.10 °C 9.10–9.90

Precipitation270 mm/mo 194–270

Air humidity64.2 % 62.0–64.2

Moisture balance187 mm/mo

Vapour deficit515 Pa 515–627

Wind speed6.00 m/s

Cloud cover48.0 % 46.1–48.0

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Thorogobius ephippiatus

At a glance

Sources13 archives

Size & morphology1

Life cycle & reproduction1

Habitat & environment2

Other traits3

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type10 073 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type10 073 records