Thelymitra campanulata

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Thelymitra

At a glance

Occurrence records202

Data sources6

Biological traits24

DNA specimens1

eDNA detections1

Sources6 archives

Databases and archives Thelymitra campanulata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility202 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources24 traits

Occurrence & distributionGBIF202 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Thelymitra campanulata là một loài thực vật có hoa trong họ Lan. Loài này được Lindl. miêu tả khoa học đầu tiên năm 1840.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology5

Leaf length175 mm

Leaf width4.5 mm

Plant height0.5 m

Plant height max0.5 m

Plant height min0.2 m

Life cycle & reproduction7

Flowering timennnnnnnyyynn

Life formtuberous geophyte

Life spanperennial

Lifespan years6 years

Raunkiær life formcryptophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Thelymitra campanulata has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences4

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSMG694962.1 ↗699 bp

ACGT

CATTGTCGAGACCCGCAAGAGACCGAGCAATTTTGACAACCAGTGAACTAAATGTACGGCGGAAGCGAAAGCTTCCCGTCGCCATCGCCC …

Thelymitra campanulata voucher Clements, M.A. 11976B (CANB) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type202 records

Wild obs. + sensor80

Museum / vouchered118

Cultivated / captive4

Origin

Native4

Range

Area of Occupancy AOO600 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 29≤1 km 14≤10 km 4>10 km 22

69 georeferenced · 11 without coordinates

Open the mapobservation + sensor80

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 15≤1 km 5≤10 km 62>10 km 14

96 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence118

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy50% within 1 km

≤1 km 2≤10 km 1>10 km 1

4 georeferenced

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	54
Museo Entomologico de Leonlocation not on record	22
Canberra, AU	18
Adelaide, AU	15
Mount Annan, AU	4
BGPAlocation not on record	3
Claremont, US	1
Smithfield, AU	1

8 institutions · 118 of 118 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Thelymitra campanulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)