Teucrium abutiloides

L'Hér. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Teucrium

At a glance

Occurrence records17

Data sources9

Biological traits1

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Teucrium abutiloides's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility17 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Chemical compositionLOTUS · NPASS11 compounds

Occurrence & distributionGBIF17 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Teucrium abutiloides est une espèce de plantes à fleurs de la famille des Lamiacées et du genre des Germandrées. Elle est endémique des falaises au Nord de l'île de Madère où elle est considérée comme en danger critique d'extinction par l'Union internationale pour la conservation de la nature.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVP

Habitat & environment1

Climatesubtropical

03Chemical composition11 compounds

Compounds documented for Teucrium abutiloides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Colensane and Clerodane diterpenoids5

Cholestane steroids $ Stigmastane steroids3

Cholestane steroids2

Cholestane steroids $ Ergostane steroids1

Documented compounds11 total

Tissue Source Quantified only

Compound	Amount	Source
(3S,8R,9S,10R,13R,14S,17R)-17-[(2R,3E,5S)-5-ethyl-6-methylhepta-3,6-dien-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	LOTUS
(3S,8S,9R,10R,13R,14S,17R)-17-[(E,2R,5R)-5,6-dimethylhept-3-en-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
[(1R,4R,6S,8R,9S,13R,14S,16R)-6-(furan-3-yl)-16-methylspiro[3,5-dioxatetracyclo[6.5.3.01,9.04,8]hexadecane-13,2'-oxirane]-14-yl] acetate	present	LOTUS
[(1R,4S,6S,8S,9S,13R,14S,16R)-6-(furan-3-yl)-16-methylspiro[3,5-dioxatetracyclo[6.5.3.01,9.04,8]hexadecane-13,2'-oxirane]-14-yl] acetate	present	LOTUS
[(3S,8R,9S,10R,13R,14S,17R)-17-[(2R,3E,5S)-5-ethyl-6-methylhepta-3,6-dien-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate	present	LOTUS
[(3S,8R,9S,10R,13R,14S,17R)-17-[(2R,5S)-5-ethyl-6-methylhept-6-en-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate	present	LOTUS
[(3S,8R,9S,10R,13R,14S,17R)-17-[(E,2R,5R)-5-ethyl-6-methylhept-3-en-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate	present	LOTUS
Cholesterol	present	NPASS
CID 101526594	present	LOTUS
CID 13944860	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Teucrium abutiloides has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJN575357.1 ↗697 bpPortugal

ACGT

AGGAAGGAAAGTCGTAACAAGGTTTCCTACGTAACCTGCGGAAGGATCATTGTCGAAACCTGCAAAGCAGACCGCGAACACGTGTTTAAC …

Teucrium abutiloides isolate abu360119 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1★ITS2

fungal barcode

08Occurrence & distribution

Record type17 records

Wild obs. + sensor10

Museum / vouchered7

Range

Area of Occupancy AOO52 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 4>10 km 6

10 georeferenced

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 7 records without

Open the institutions mapphysical evidence7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	4
Hazara Universitylocation not on record	1
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	1

3 institutions · 6 of 7 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Teucrium abutiloides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.4 °C 15.4–15.4

Seasonal swing summer↔winter15.3 °C

Max temp (day)20.5 °C

Min temp (night)10.4 °C

Precipitation70.4 mm/mo

Air humidity57.7 %

Moisture balance-28.0 mm/mo

Vapour deficit804 Pa

Wind speed2.90 m/s

Cloud cover41.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)