Tetraselmis suecica

(Kylin) Butcher · species

image placeholder — illustration coming later

Plantae/Chlorophyta/Prasinophyceae/Chlorodendrales/Chlorodendraceae/Tetraselmis

At a glance

Occurrence records22

Data sources10

Biological traits1

DNA specimens4

eDNA detections5

Sources10 archives

Databases and archives Tetraselmis suecica's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility12 records↗

OBISOcean Biodiversity Information System10 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.34 Gbp↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF · OBIS22 records

Environmental DNA2 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceGoaT342 Mbp

01Narrative

Tetraselmis suecica is a marine green alga. It grows as single, motile cells visible under light microscope up to concentrations over one million cells per milliliter. It can be grown as a foodstock in aquaculture, being amenable to species such as rotifers of the genus Brachionus. It is a motile chlorophyte and contains a high lipid content. T. suecica proved to have cytotoxic effects on HL-60, MCF-7 and NCI-H460 tumor cells and antioxidant activity. Therefore, they could offer greater benefits as possible natural nutraceuticals for the pharmaceutical industry. More studies are necessary to identify the specific bioactive fractions of each EPS Text was copied from this source, which is available under a Creative Commons Attribution 4.0 International License. Adarme-Vegas et al. (2014)Adarme-Vegas, T.C., S.R. Thomas-Hall, D.K.Y. Lim, and P.M. Schenk, 2014.Marine Drugs 12(6): 3381-3398 state that a reduction in biomass of Tetraselmis spp. was observed in high salinity cultures (50 ppt) as well as in near-freshwater salinity cultures (5 and 10 ppt). Changes in salinity primarily altered biomass productivity with cultures in 30 and 40 ppt having the highest growth rate and final productivity. Salinity had no effect on the percentage of EPA or total Fatty Acid production.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment1

Habitat saltwateryes

03Chemical composition4 compounds

Compounds documented for Tetraselmis suecica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Carotenoids (C40, β-β)2

Carotenoids (C40, β-ε)2

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
(1R)-4-[(1E,3E,5E,7E,9E,11E,13E,15E,17E)-18-[(4R)-4-hydroxy-2,6,6-trimethylcyclohex-2-en-1-yl]-3,7,12,16-tetramethyloctadeca-1,3,5,7,9,11,13,15,17-nonaenyl]-3,5,5-trimethylcyclohex-3-en-1-ol	present	LOTUS
(3S)-6-[(1E,3E,5E,7E,9E,11E,13E,15E,17E)-18-[(4R)-4-hydroxy-2,6,6-trimethylcyclohexen-1-yl]-3,7,12,16-tetramethyloctadeca-1,3,5,7,9,11,13,15,17-nonaenyl]-1,5,5-trimethyl-7-oxabicyclo[4.1.0]heptan-3-ol	present	LOTUS
Loroxanthin	present	LOTUS
Violaxanthin	present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tetraselmis suecica has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences8

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY574382.1 ↗589 bp

ACGT

GAAGGTCTTGAATCGATCAATCCACACTGTGAACTGTTTGTCTCCCTCTCGGGGCCGCTCGCGCGGCCGCTTGAGCGGCTAGGGATGCGT …

Tetraselmis suecica internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL5★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Tetraselmis suecica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size342 300 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Tetraselmis suecica0.34 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type22 records

Wild obs. + sensor1

Museum / vouchered3

Cultivated / captive4

Other14

Range

Area of Occupancy AOO32 km²

Depth

0–200 m sunlit6

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 2.5 m · max 15 m · 6 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the institutions mapphysical evidence3

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 2 without coordinates

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Marine Biodiversity Institute of Korealocation not on record	1
Stockholm, SE	1

2 institutions · 2 of 3 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Tetraselmis suecica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys2

Countries1

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 16.7–16.7

Seasonal swing summer↔winter16.1 °C

Max temp (day)18.2 °C

Min temp (night)15.0 °C

Precipitation83.3 mm/mo

Air humidity62.8 %

Moisture balance-20.5 mm/mo

Vapour deficit708 Pa

Wind speed4.10 m/s

Cloud cover47.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)