Tetraopes annulatus

LeConte, 1847 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Cerambycidae/Tetraopes

At a glance

Occurrence records319

Data sources7

Biological traits0

DNA specimens19

eDNA detections18

Sources7 archives

Databases and archives Tetraopes annulatus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility319 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF319 records

Environmental DNA1 datasets · 2 countries18 detections

DNA & barcodingBOLD19 specimens

01Narrative

Tetraopes annulatus is a species of beetle in the family Cerambycidae. It was described by John Lawrence LeConte in 1847. It is known from the United States and Canada.BioLib.cz - Tetraopes annulatus. Retrieved on 8 September 2014. Reported feeding on Asclepias sullivantii, A. subverticillata, A. speciosa, A. tuberosa, A. verticillata, A. viridiflorus.Bugguide.net. Genus Tetraopes - Milkweed Longhorns

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tetraopes annulatus has left across the world's sequence archives.

At a glance

DNA specimens19

BINs2

Marker genes1

eDNA detections18

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P570 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 50 variable positions, in barcode order

27Gmostly conserved

28Amostly conserved

30Tmostly conserved

31Tmostly conserved

34Gmostly conserved

35Amostly conserved

36Tmostly conserved

38Tmostly conserved

39Cmostly conserved

40Cmostly conserved

41Amostly conserved

42Gmostly conserved

43Gmostly conserved

44Amostly conserved

46Cmostly conserved

48Tmostly conserved

50Amostly conserved

51Amostly conserved

52Tmostly conserved

53Tmostly conserved

54Gmostly conserved

55Gmostly conserved

56Amostly conserved

57Gmostly conserved

81Gmostly conserved

87Gmostly conserved

99Amostly conserved

130Tmostly conserved

170Amostly conserved

176Tvariable

189Tmostly conserved

191Tmostly conserved

192Cmostly conserved

195Cmostly conserved

219Tmostly conserved

242Amostly conserved

274Tvariable

299Amostly conserved

302Amostly conserved

304Tmostly conserved

327Gmostly conserved

328Gmostly conserved

329Tmostly conserved

356Avariable

419Tmostly conserved

479Cvariable

488Cvariable

489Cvariable

539Gmostly conserved

551Cvariable

CATCATTAAGATTATTAATTCGATCAGAATTAGGATCTCCAGGATCATTAATTGGAGATGATCAAATTTATAATTCCATTGTTACTGCCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes5

BINs2

Most divergent pair1.6%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tetraopes tetrophthalmussame genus5.6%Tetraopes femoratussame genus7.2%Tetraopes texanussame genus8.4%Olenecamptus bilobussame family11.1%Oberea quadricallosasame family11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type319 records

Wild obs. + sensor223

Museum / vouchered96

Range

Area of Occupancy AOO828 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 109≤1 km 33≤10 km 11>10 km 20

173 georeferenced · 50 without coordinates

Open the mapobservation + sensor223

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤1 km 1≤10 km 16>10 km 2

19 georeferenced · 77 without coordinates

Open the institutions mapphysical evidence96

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WIlocation not on record	29
Royal Saskatchewan Museumlocation not on record	14
University of Alberta Museums (UAM)location not on record	12
Lexington, US	6
University Park, US	6
Provo, US	3
University of Nebraska State Museumlocation not on record	3
Champaign, US	2
Chicago, US	1
Cambridge, US	1
Albuquerque, US	1
Montana State Universitylocation not on record	1
Colorado State Universitylocation not on record	1
US	1

14 institutions · 81 of 96 vouchered records shown · 15 without an institution code

09Environmental DNA18 detections

Where the DNA of Tetraopes annulatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.0 °C 18.4–23.4

Seasonal swing summer↔winter25.4 °C

Max temp (day)27.4 °C 26.1–31.0

Min temp (night)15.3 °C 12.3–17.4

Precipitation48.7 mm/mo 47.0–87.5

Air humidity49.0 % 46.7–53.4

Moisture balance-102 mm/mo -146–-86.6

Vapour deficit1,256 Pa 1,010–1,486

Wind speed3.90 m/s 2.20–5.10

Cloud cover26.8 % 18.3–33.0

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)