Tetramorium humbloti

Forel, 1891 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Formicidae/Tetramorium

At a glance

Occurrence records385

Data sources6

Biological traits0

DNA specimens42

eDNA detections59

Sources6 archives

Databases and archives Tetramorium humbloti's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility385 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI59 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics42 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF385 records

Environmental DNA1 datasets · 6 countries59 detections

DNA & barcodingBOLD42 specimens

01Narrative

Tetramorium humbloti is een mierensoort uit de onderfamilie van de Myrmicinae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1891 door Forel.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding42 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tetramorium humbloti has left across the world's sequence archives.

At a glance

DNA specimens42

BINs2

Marker genes1

eDNA detections59

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus33 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 35 variable positions, in barcode order

3Cmostly conserved

42Amostly conserved

91Cmostly conserved

99Tmostly conserved

138Cmostly conserved

180Amostly conserved

186Tmostly conserved

204Tmostly conserved

222Tmostly conserved

225Tmostly conserved

234Cmostly conserved

237Tmostly conserved

270Cmostly conserved

294Tmostly conserved

318Tmostly conserved

327Tmostly conserved

333Cmostly conserved

345Amostly conserved

351Tmostly conserved

372Tmostly conserved

375Tmostly conserved

399Tmostly conserved

414Cvariable

468Cmostly conserved

495Cmostly conserved

525Cmostly conserved

535Tmostly conserved

540Cmostly conserved

552Gmostly conserved

585Tmostly conserved

594Cmostly conserved

624Avariable

627Amostly conserved

633Tmostly conserved

652Tmostly conserved

ATCCTTTATTTTTTATTTGCAATTTGAGCAGGAATAATTGGATCTTCAATAAGAATAATTATTCGATTAGAATTAGGAACATGTAATTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes5

BINs2

Most divergent pair5.3%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tetramorium weitzeckerisame genus4.4%Tetramorium norvigisame genus8.1%Tetramorium guineensesame genus8.2%Tetramorium andreisame genus9.0%Tetramorium snellingisame genus9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type385 records

Wild obs. + sensor4

Museum / vouchered381

Range

Area of Occupancy AOO388 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 1>10 km 3

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced · 378 without coordinates

Open the institutions mapphysical evidence381

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	261
Cambridge, US	75
Cape Town, ZA	25
California Academy of Scienceslocation not on record	7

4 institutions · 368 of 381 vouchered records shown · 13 without an institution code

09Environmental DNA59 detections

Where the DNA of Tetramorium humbloti was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found59

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 59 detections have coordinates

Open the map6 countries0

3. Shrubland | 3.6. Subtropical/Tropical Moi…Alluvial Plains

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.0 °C 21.4–26.6

Seasonal swing summer↔winter5.20 °C

Max temp (day)26.2 °C 24.5–29.6

Min temp (night)21.0 °C 17.2–24.9

Precipitation121 mm/mo 83.7–232

Air humidity63.6 % 60.9–68.2

Moisture balance-12.6 mm/mo

Vapour deficit1,015 Pa 925–1,296

Wind speed2.90 m/s

Cloud cover30.4 % 19.0–46.5

CHELSA 1981–2010, ~9 km grid, at location & month of 59 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)