Tetradium daniellii

(Benn.) T.G.Hartley · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Tetradium

At a glance

Occurrence records644

Data sources12

Biological traits16

DNA specimens8

eDNA detections6

Sources12 archives

Databases and archives Tetradium daniellii's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility644 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Chemical compositionLOTUS31 compounds

Occurrence & distributionGBIF644 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceCCDB2n = 72

01Narrative

Tetradium daniellii, the bee-bee tree or Korean evodia, is a species of flowering plant in the family Rutaceae. It is native to Korea and southwestern China. Tetradium daniellii var. hupehensis was formerly classed as Euodia hupehensis Bark of ''T. daniellii''

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height18.75 m

Seed mass5.33 mg

Seed mass max5.3 mg

Seed mass min5.3 mg

Life cycle & reproduction3

Deciduousnessdeciduous

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Shrub, Tree

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Specific leaf area (SLA)19.61 mm²/mg

03Chemical composition31 compounds

Compounds documented for Tetradium daniellii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Furocoumarins $ Simple coumarins16

Flavanones5

Stigmastane steroids2

Furofuranoid lignans1

Limonoids1

Documented compounds31 total

Tissue Source Quantified only

Compound	Amount	Source
(2S)-5-hydroxy-2-(3-hydroxy-4-methoxyphenyl)-7-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2R,3R,4S,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-2-yl]oxy-2,3-dihydrochromen-4-one	present	LOTUS
1D-chiro-inositol	present	LOTUS
4-(7-Hydroxy-3,7-dimethylocta-2,5-dienoxy)furo[3,2-g]chromen-7-one	present	LOTUS
4-[(2E,6R)-6-hydroxy-3,7-dimethylocta-2,7-dienoxy]furo[3,2-g]chromen-7-one	present	LOTUS
4-[(3,7-Dimethyl-2,6-octadien-1-yl)oxy]-7H-furo[3,2-g][1]benzopyran-7-one	present	LOTUS
4-[(E)-5-[(2R)-3,3-dimethyloxiran-2-yl]-3-methylpent-2-enoxy]furo[3,2-g]chromen-7-one	present	LOTUS
8-Geranyloxypsoralen	present	LOTUS
9-((3,7-Dimethylocta-2,6-dien-1-yl)oxy)-7H-furo[3,2-g]chromen-7-one	present	LOTUS
9-((7-Hydroxy-3,7-dimethylocta-2,5-dien-1-yl)oxy)-7H-furo[3,2-g]chromen-7-one	present	LOTUS
9-(7-Hydroxy-3,7-dimethylocta-2,5-dienoxy)furo[3,2-g]chromen-7-one	present	LOTUS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tetradium daniellii has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes3

GenBank sequences7

eDNA detections6

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOR234894.1 ↗386 bp

ACGT

ATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTTAGGCCGAGGGCACGT …

Tetradium daniellii isolate A91 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Tetradium daniellii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 72 n = 36

Ploidypolyploid inferred

Chromosome records72–802n range72median72mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 724×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Bowden 1945b

CCDB · book-atlas-flowering-plants — Bowden 1945b

CCDB · book-atlas-flowering-plants

2n 761×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Guerra, M. d. S. 1984. New chromosome numbers in Rutaceae. Pl. Syst. Evol. 146: 13–30.

2n 781×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Guerra, M. d. S. 1984. New chromosome numbers in Rutaceae. Pl. Syst. Evol. 146: 13–30.

2n 801×CCDB · book-fedorov

CCDB · book-fedorov — Desai 1955, 1960

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type644 records

Wild obs. + sensor270

Museum / vouchered131

Cultivated / captive243

Range

Area of Occupancy AOO1 060 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 126≤1 km 48≤10 km 14>10 km 5

193 georeferenced · 77 without coordinates

Open the mapobservation + sensor270

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 13≤1 km 11≤10 km 23

47 georeferenced · 84 without coordinates

Open the institutions mapphysical evidence131

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 241 without coordinates

Open the mapnot free-living243

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions30 of 51 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	12
Bronx, US	9
Herbarium of the Department of Botany, University of Tokyolocation not on record	9
National Institute of Biological Resourceslocation not on record	8
Tempe, US	4
Millersville, US	4
Riverside, US	4
Chicago, US	4
Cambridge, US	4
Kew, GB	3
Philadelphia, US	3
Springfield, US	3
Rotorua, NZ	3
Tomioka, JP	3
Kyoto Universitylocation not on record	3
SLU Artdatabankenlocation not on record	2
Saint Louis, US	2
Adam Mickiewicz University in Poznańlocation not on record	2
Vancouver, CA	2
LDlocation not on record	2
BIO-UNIPIlocation not on record	2
Beijing Normal Universitylocation not on record	2
Canadian Department of Agriculturelocation not on record	2
Guilin, CN	2
Fairfax, US	2
Beijing, CN	1
Oskarshamn, SE	1
USP-IBlocation not on record	1
Görlitz, DE	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Stockholm, SE	1
Wlocation not on record	1
Northridge, US	1
Frankfurt am Main	1
Chongqing Museumlocation not on record	1
Zhejiang Universitylocation not on record	1
Uniwersytet Wrocławskilocation not on record	1
GAlocation not on record	1
Wuzhou, CN	1
Dover, US	1
Philadelphia, US	1
SDFlocation not on record	1
Elocation not on record	1
Herbarium of South China Botanical Gardenlocation not on record	1
Edinburgh, GB	1
FFPRIlocation not on record	1
Dekalb, US	1
Lord Fairfax Community Collegelocation not on record	1
JP	1
Helsinki, FI	1
Davis, US	1

51 institutions · 122 of 131 vouchered records shown · 8 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Tetradium daniellii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.20 °C -0.2–18.6

Seasonal swing summer↔winter22.3 °C

Max temp (day)13.1 °C 3.30–22.8

Min temp (night)4.50 °C -4.90–14.0

Precipitation137 mm/mo 107–168

Air humidity60.0 % 59.9–60.2

Moisture balance43.5 mm/mo -16.4–103

Vapour deficit609 Pa 297–922

Wind speed4.60 m/s 2.80–6.40

Cloud cover41.0 % 36.4–45.6

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)