Testudinella patina

(Hermann, 1783) · species

image placeholder — illustration coming later

Animalia/Rotifera/Eurotatoria/Flosculariaceae/Testudinellidae/Testudinella

At a glance

Occurrence records911

Data sources6

Biological traits2

DNA specimens16

eDNA detections15

Sources6 archives

Databases and archives Testudinella patina's data was compiled from.

GBIFGlobal Biodiversity Information Facility890 records↗

OBISOcean Biodiversity Information System21 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS911 records

Environmental DNA1 datasets · 3 countries15 detections

DNA & barcodingBOLD16 specimens

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat freshwateryes

Habitat zonepelagic

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Testudinella patina has left across the world's sequence archives.

At a glance

DNA specimens16

BINs5

Marker genes1

eDNA detections15

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P661 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

5Cvariable

7Amostly conserved

34Avariable

265Cmostly conserved

337Tmostly conserved

373Amostly conserved

412Tmostly conserved

652Amostly conserved

AACTCTATATTTTATTTTTGGTTTATGGGCAGGAATGATTGGGTTAGCTATAAGTCTTATTATTCGAGTTGAATTGGGGGTTGTGGGACC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.66%

Haplotypes3

BIN1

Most divergent pair0.91%

N.America

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type911 records

Wild obs. + sensor248

Museum / vouchered591

Cultivated / captive34

Other38

Origin

Native100

Range

Area of Occupancy AOO2 200 km²

Depth

0–200 m sunlit7

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 4 m · max 4.5 m · 7 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 125≤1 km 36≤10 km 15>10 km 4

180 georeferenced · 68 without coordinates

Open the mapobservation + sensor248

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 151≤1 km 1≤10 km 5>10 km 4

161 georeferenced · 430 without coordinates

Open the institutions mapphysical evidence591

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 34 records without

Open the mapnot free-living34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CNR-IRSAlocation not on record	93
National Institute of Biological Resourceslocation not on record	30
Princess Maha Chakri Sirindhorn Natural History Museum (PSU Museum, Prince of Songkla University, Thailand)location not on record	17
New Haven, US	10
Tapachula, MX	7
Centro de Investigaciones Biológicas, Universidad Autónoma del Estado de Moreloslocation not on record	6
EL PASO, US	2
Wuzhou, CN	2
Washington, US	2
Tlalnepantla, MX	1
Sydney, AU	1
WoRMS Editorial Boardlocation not on record	1
Copenhagen, DK	1

13 institutions · 173 of 591 vouchered records shown · 402 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA15 detections

Where the DNA of Testudinella patina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.1 °C 10.1–25.6

Seasonal swing summer↔winter10.7 °C

Max temp (day)11.8 °C 11.8–27.0

Min temp (night)7.90 °C 7.90–23.4

Precipitation93.6 mm/mo 93.6–406

Air humidity63.4 % 63.4–73.5

Moisture balance22.4 mm/mo 22.4–253

Vapour deficit469 Pa 469–869

Wind speed4.80 m/s 1.70–4.80

Cloud cover50.0 % 28.1–50.0

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)