Termitomyces heimii

Natarajan · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Lyophyllaceae/Termitomyces

At a glance

Occurrence records71

Data sources9

Biological traits0

DNA specimens8

eDNA detections51

Sources9 archives

Databases and archives Termitomyces heimii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

GBIFGlobal Biodiversity Information Facility71 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI51 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF71 records

Environmental DNA2 datasets · 2 countries51 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceGoaT · NCBI≈57 Mbp

01Narrative

Termitomyces heimii is a species of agaric fungus in the family Lyophyllaceae. It has symbiotic relationship with termites. Described as new to science in 1979, it is found in India. The specific epithet heimii honors French mycologist Roger Heim. The fruit bodies (mushrooms) produced by the fungus are edible.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Termitomyces heimii has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes2

GenBank sequences10

eDNA detections51

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPQ522230.1 ↗217 bpIndia · 2024

ACGT

TTGGGTTGTTGCTGGCCTCTAGGGGCATGTGCACGCCTGCCACCGTTTTCCAACCACCTGTGCACCTTTTGTAGACTTTGGATATATACT …

Termitomyces heimii isolate TMA18 internal transcribed spacer region, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Termitomyces heimii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈56 872 381 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Termitomyces heimii0.06 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness91% BUSCO

08Occurrence & distribution

Record type71 records

Wild obs. + sensor7

Museum / vouchered64

Range

Area of Occupancy AOO224 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 2

5 georeferenced · 2 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 64 records without

Open the institutions mapphysical evidence64

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Gujarat Biodiversity Gene Banklocation not on record	4
Philadelphia, US	1
Natural History Museum, Tribhuvan Universitylocation not on record	1

3 institutions · 6 of 64 vouchered records shown · 58 without an institution code

09Environmental DNA51 detections

Where the DNA of Termitomyces heimii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found51

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 51 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH5.30 3.70–7.10

Conductivity55.0 µS/cm 11.0–251

Organic carbon2.98 % 0.003–6.24

Water content25.0 % 2.02–88.6

Nitrate-N5.50 mg/kg 0.145–125

Phosphorus10.5 mg/kg 2.00–49.0

Clay16.9 % 1.61–35.3

Sand60.4 % 13.8–96.1

Depth0 m 0–0.2

SoilDermosolsTenosolHydrosolChromosolKurosolVertosol

42 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.5 °C 9.70–27.0

Seasonal swing summer↔winter12.0 °C

Max temp (day)23.8 °C 13.4–29.4

Min temp (night)11.5 °C 6.90–25.0

Precipitation80.6 mm/mo 46.1–311

Air humidity58.9 % 53.3–66.4

Moisture balance-27.5 mm/mo -111–163

Vapour deficit829 Pa 465–1,289

Wind speed2.60 m/s 1.50–4.10

Cloud cover23.5 % 11.4–62.8

CHELSA 1981–2010, ~9 km grid, at location & month of 47 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)