Terminalia arjuna

(Roxb.) Wight & Arn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Combretaceae/Terminalia

At a glance

Occurrence records2 457

Data sources15

Biological traits22

DNA specimens42

eDNA detections25

Sources15 archives

Databases and archives Terminalia arjuna's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 457 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics42 specimens↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Chemical compositionDukesPhytochem · LOTUS · NPASS104 compounds

Occurrence & distributionGBIF2 457 records

Environmental DNA1 datasets · 3 countries25 detections

DNA & barcodingBOLD · NCBI42 specimens

Genome at a glanceCCDB · GoaT · NCBI3.5 Gbp

01Narrative

Terminalia arjuna Terminalia arjuna lower trunk Terminalia arjuna is a tree of the genus Terminalia. It is commonly known as arjuna or arjun tree in English.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height30 m

Seed mass1 470 mg

Seed mass max2 000 mg

Seed mass min439 mg

Life cycle & reproduction3

Deciduousnessdeciduous

⚠ sources differ — TRY: deciduous · GIFT: evergreen

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry8

Leaf C:N ratio27.27 g/g

Leaf c397 mg/g

Leaf n14.6 mg/g

Leaf p1.8 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)7.62 mm²/mg

Wood density703 mg/cm³

03Chemical composition104 compounds

Compounds documented for Terminalia arjuna across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

💊 Medicinal use documented

Compound class profile5 classes

Gallotannins13

Oleanane triterpenoids11

Flavandiols (Leucoanthocyanidins)2

Flavones2

Chalcones2

Documented compounds104 total

Tissue Source Quantified only

Compound	Amount	Source
TANNIN	158,000 ppm	DukesPhytochem
PROTEIN	101,000 ppm	DukesPhytochem
FIBER	77,800 ppm	DukesPhytochem
ASH	70,900 ppm	DukesPhytochem
SUGARS	57,500 ppm	DukesPhytochem
ARJUNOLIC-ACID	30,000 ppm	DukesPhytochem
ARJUNETIN	1,600 ppm	DukesPhytochem
ARJUNOLIC-ACID-SAPONIN	1,300 ppm	DukesPhytochem

05DNA & barcoding42 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Terminalia arjuna has left across the world's sequence archives.

At a glance

DNA specimens42

Marker genes6

GenBank sequences10

eDNA detections25

Countries3

The DNA barcodea real sequence read deposited for this species

rbcLPP868245.1 ↗677 bpIndia

ACGT

GATTATAAACTGACTTATTATACTCCTGACTATCAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTT …

Terminalia arjuna voucher 32022 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL7★rbcLa★ITS★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Terminalia arjuna carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size3 520 800 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Terminalia arjuna3.52 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidy2× diploid · measured

Chromosome records24–262n range24median24mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 246×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-indian_vol1 +3

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Ohri, D. 1996. Genome size and polyploidy variation in the tropical hardwood genus Terminalia (Combretaceae). Pl. Syst. Evol. 200: 225–232.

CCDB · book-indian_vol1 — Janaki Ammal, E.K. 1962; Sanjappa, M. 1979

CCDB · book-fedorov — Janaki Punmal 1962

CCDB · kew — Ohri D. 1996. Genome size and polyploidy variation in the tropical hardwood genus Terminalia (Combretaceae). Plant Systematics and Evolution 200: 225-232.

CCDB · Cave1962 — Janaki-Ammal 1962b

2n 262×CCDB · book-indian_vol1 · CCDB · book-fedorov

CCDB · book-indian_vol1 — Sen, S. 1955b

CCDB · book-fedorov — Sen S. 1955b

n 122×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Sanjappa, M. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 274–275.

CCDB · book-ipcn75-78 — Mehra 1976

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type2 457 records

Wild obs. + sensor2 340

Museum / vouchered116

Cultivated / captive1

Origin

Native1

Range

Area of Occupancy AOO2 412 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 159≤1 km 75≤10 km 42>10 km 14

290 georeferenced · 2 050 without coordinates

Open the mapobservation + sensor2 340

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤1 km 21≤10 km 6>10 km 3

30 georeferenced · 86 without coordinates

Open the institutions mapphysical evidence116

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Baroda, IN	13
Pondicherry, IN	11
Tampa, US	9
Sri Ramaswamy Memorial Universitylocation not on record	6
Miami, US	6
Beijing, CN	5
St. Augustine, TT	5
Taipei, TW	4
National Institute of Biological Resourceslocation not on record	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Central Institute of Medicinal and Aromatic Plantslocation not on record	3
Dehra Dun, IN	3
Guangzhou, CN	2
Kew, GB	2
Montréal, CA	2
Uniwersytet Śląski w Katowicachlocation not on record	1
Wellington, NZ	1
Saint Louis, US	1
Xiamen, CN	1
Uppsala, SE	1
Fort Worth, US	1
Cape Town, ZA	1
Bloomington, US	1
TAFORI-LSRClocation not on record	1
University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record	1
Durban, ZA	1
Alexandria Universitylocation not on record	1
Logan, US	1
Gujarat Biodiversity Gene Banklocation not on record	1
Stockholm, SE	1

30 institutions · 92 of 116 vouchered records shown · 22 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA25 detections

Where the DNA of Terminalia arjuna was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found25

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 25 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 23.9–25.1

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C 25.7–30.5

Min temp (night)19.3 °C 19.3–20.8

Precipitation109 mm/mo 98.6–109

Air humidity52.0 % 52.0–61.1

Moisture balance-17.8 mm/mo

Vapour deficit1,616 Pa 1,035–1,616

Wind speed1.80 m/s

Cloud cover25.2 % 25.2–26.2

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Terminalia arjuna

At a glance

Sources15 archives

Size & morphology4

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

Physiology & chemistry8

Compound class profile5 classes

Documented compounds104 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type2 457 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions21 of 30 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 457 records