Tenualosa ilisha

(Hamilton, 1822) · species

image placeholder — illustration coming later

Animalia/Chordata/Clupeiformes/Clupeidae/Tenualosa

At a glance

Occurrence records672

Data sources13

Biological traits10

DNA specimens63

eDNA detections71

Sources13 archives

Databases and archives Tenualosa ilisha's data was compiled from.

WikipediaWikimedia Foundation14 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility559 records↗

OBISOcean Biodiversity Information System113 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI71 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics63 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources10 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF · OBIS672 records

Environmental DNA1 datasets · 2 countries71 detections

DNA & barcodingBOLD63 specimens

Genome at a glanceGoaT · NCBI≈816 Mbp

01Narrative

The ilish (Tenualosa ilisha) (; also known as the ilishi, hilsa, hilsa herring or hilsa shad, is a species of fish related to the herring, in the family Clupeidae. It is a very popular and sought-after food fish in the Indian Subcontinent, and is the national fish of Bangladesh and the state fish of West Bengal. The most famous hilsha fish comes from Chandpur, Bangladesh. The fish contributes about 12% of the total fish production and about 1.15% of GDP in Bangladesh. On 6 August 2017, Department of Patents, Designs and Trademarks under the Ministry of Industries of Bangladesh has declared the recognition of ilish as the product of Bangladesh. As of 2021, 86% of the world's total ilish supply originates in Bangladesh which applied for Geographical indication (GI) in 2004. About 450,000 people are directly involved in the catching of the fish as a large part of their livelihood; around four to five million people are indirectly involved with the trade.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length60 cm

Body mass680 g

Life cycle & reproduction1

Max. longevity60 months

Habitat & environment4

Habitat brackishyes

Habitat freshwateryes

Habitat saltwateryes

Habitat zonepelagic-neritic

Uses & economy1

Commercial importanceminor commercial

Other traits2

Depth max200 m

Vulnerability28.99

03Chemical composition1 compounds

Compounds documented for Tenualosa ilisha across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Cholestane steroids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Chethoxyrol		present	LOTUS

05DNA & barcoding63 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tenualosa ilisha has left across the world's sequence archives.

At a glance

DNA specimens63

BINs1

Marker genes5

eDNA detections71

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P618 bp consensus59 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

26Gmostly conserved

91Tmostly conserved

151Avariable

181Cmostly conserved

188Tmostly conserved

271Gmostly conserved

277Cvariable

286Avariable

466Avariable

578Gmostly conserved

613Cvariable

616Gvariable

TGCTTTGAGTCTTCTGATCCGGGCAGAGCTAAGCCAACCCGGGTCTCTCCTTGGAGATGACCAAATCTATAATGTTATCGTTACAGCGCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes17

BIN1

Most divergent pair3.7%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tenualosa macrurasame genus12.1%Tenualosa tolisame genus12.6%Tenualosa thibaudeauisame genus13.4%Gudusia chaprasame family14.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5Patp6COIICOXIIICYTB

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_016682 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBs-rRNAl-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Tenualosa ilisha carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈815 647 530 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Tenualosa ilisha0.82 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness95.4% BUSCO

07Deep time~14 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin14 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type672 records

Wild obs. + sensor72

Museum / vouchered599

Other1

Origin

Native1

Range

Area of Occupancy AOO416 km²

Depth

0–200 m sunlit3

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 16 m · max 37 m · 3 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy18% within 1 km

≤100 m 1≤1 km 3≤10 km 8>10 km 10

22 georeferenced · 50 without coordinates

Open the mapobservation + sensor72

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 8≤10 km 14>10 km 16

38 georeferenced · 561 without coordinates

Open the institutions mapphysical evidence599

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	12
Paris, FR	8
Stockholm, SE	4
Vancouver, CA	4
Washington, US	4
Frankfurt am Main	3
Montgomery, US	2
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Cambridge, US	1
	1
Louisiana State University, Museum of Zoologylocation not on record	1
Ann Arbor, US	1

12 institutions · 42 of 599 vouchered records shown · 491 without an institution code

09Environmental DNA71 detections

Where the DNA of Tenualosa ilisha was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found71

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 71 detections have coordinates

Open the map2 countries0

Mangrove

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.8 °C 24.7–27.7

Seasonal swing summer↔winter10.5 °C

Max temp (day)29.5 °C 27.4–32.4

Min temp (night)21.4 °C 21.0–24.5

Precipitation174 mm/mo 45.9–238

Air humidity61.1 % 55.5–65.8

Moisture balance37.8 mm/mo -96.4–137

Vapour deficit1,263 Pa 1,190–1,603

Wind speed2.90 m/s 1.70–5.30

Cloud cover34.3 % 13.3–48.9

CHELSA 1981–2010, ~9 km grid, at location & month of 40 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)