Templetonia drummondii

Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Templetonia

At a glance

Occurrence records70

Data sources4

Biological traits14

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Templetonia drummondii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility70 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF70 records

DNA & barcodingNCBIsequences

01Narrative

Templetonia drummondii là một loài thực vật có hoa trong họ Đậu. Loài này được Benth. miêu tả khoa học đầu tiên.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsWCVPGIFT

Size & morphology3

Plant height0.25 m

Plant height max0.4 m

Plant height min0.1 m

Life cycle & reproduction3

Flowering timennnnnnnyynnn

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Fruit fleshinessdry

Fruit typelegume

Growth formshrub

Woodinesswoody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Templetonia drummondii has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPP250132.1 ↗654 bpAustralia

ACGT

AAGCAGCGCGACNCGCGAATTTGTTTGACTTGATTGGGGCGGGCAGGGGTGCTCGACGCCTCGGCCCCCCCGGTGCTGGGAGGCGCCTGC …

Templetonia drummondii voucher G.J. Keighery 6791 (PERTH) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type70 records

Wild obs. + sensor26

Museum / vouchered44

Range

Area of Occupancy AOO256 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 14≤1 km 4≤10 km 2>10 km 1

21 georeferenced · 5 without coordinates

Open the mapobservation + sensor26

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 21≤10 km 19>10 km 2

42 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence44

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	37
Museo Entomologico de Leonlocation not on record	5
Kew, GB	1
Canberra, AU	1

4 institutions · 44 of 44 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)