Telmatoblechnum indicum

(Burm.) Perrie, D.J.Ohlsen & Brownsey · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Polypodiopsida/Polypodiales/Blechnaceae/Telmatoblechnum

At a glance

Occurrence records2 840

Data sources7

Biological traits24

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Telmatoblechnum indicum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 840 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources24 traits

Occurrence & distributionGBIF2 840 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Telmatoblechnum indicum (many synonyms including Blechnum indicum) or the swamp water fern is often seen growing on sandy soils in swampy areas. The specific epithet indicum is from Latin, revealing this plant was first collected in the East Indies (Java). Indigenous Australians used the starchy rhizome as food. This plant was collected with another swamp fern Cyclosorus interruptus by Joseph Banks and Daniel Solander at Botany Bay in 1770.Les Robinson - Field Guide to the Native Plants of Sydney, page 307

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology7

Leaf length162 mm

Leaf length max700 mm

Leaf length min300 mm

Leaf width14 mm

Plant height0.75 m

Plant height max1 m

Plant height min0.5 m

Life cycle & reproduction6

Deciduousnessevergreen

Dispersal typewind

Flowering timenyyynnnnnnnn

Life formrhizomatous subshrub

Life spanperennial

Resprouting capacityresprouts

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: fern · TRY: fern

Habitat GIFTrain forest, maquis (scrubland)

Leaf compoundnesscompound

Leaf shapelanceolate oblong ovate triangular

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Telmatoblechnum indicum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLAB040558.1 ↗1 214 bp

ACGT

TGGTGTCAAAGATTACCGATTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGGATGACCCCACA …

Blechnum indicum chloroplast rbcL gene for ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2

plant barcode

08Occurrence & distribution

Record type2 840 records

Wild obs. + sensor2 108

Museum / vouchered402

Other330

Origin

Native133

Range

Area of Occupancy AOO5 648 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 1 628≤1 km 222≤10 km 77>10 km 12

1 939 georeferenced · 169 without coordinates

Open the mapobservation + sensor2 108

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 58≤1 km 49≤10 km 126>10 km 49

282 georeferenced · 120 without coordinates

Open the institutions mapphysical evidence402

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	121
Brisbane, AU	95
Canberra, AU	46
Museo Entomologico de Leonlocation not on record	35
Palmerston, AU	30
Smithfield, AU	20
Armidale, AU	14
Adelaide, AU	11
John T. Waterhouse Herbariumlocation not on record	7
NSW Dept of Planning, Industry and Environmentlocation not on record	4
Parkville, AU	4
Kensington, AU	3
Bronx, US	3
McWane Science Centerlocation not on record	3
Hobart, AU	2
Wollongong, AU	1
James Cook Townsvillelocation not on record	1
South Kensington, GB	1

18 institutions · 401 of 402 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Telmatoblechnum indicum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Telmatoblechnum indicum

At a glance

Sources7 archives

Size & morphology7

Life cycle & reproduction6

Diet & foraging1

Habitat & environment9

Physiology & chemistry1

At a glance

Record type2 840 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 840 records