Telestes pleurobipunctatus

(Stephanidis, 1939) · species

image placeholder — illustration coming later

Animalia/Chordata/Cypriniformes/Cyprinidae/Telestes

At a glance

Occurrence records320

Data sources9

Biological traits6

DNA specimens42

eDNA detections36

Sources9 archives

Databases and archives Telestes pleurobipunctatus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility320 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics42 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF320 records

Environmental DNA1 datasets · 1 countries36 detections

DNA & barcodingBOLD42 specimens

01Narrative

Telestes pleurobipunctatus is a species of ray-finned fish in the family Cyprinidae. It is found only in Greece. Its natural habitats are rivers and intermittent rivers. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length18 cm

Life cycle & reproduction1

Max. longevity108 months

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importanceof no interest

Other traits1

Vulnerability14.42

05DNA & barcoding42 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Telestes pleurobipunctatus has left across the world's sequence archives.

At a glance

DNA specimens42

BINs3

Marker genes2

eDNA detections36

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus40 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 25 variable positions, in barcode order

37Gmostly conserved

40Gmostly conserved

118Cmostly conserved

142Avariable

181Amostly conserved

184Cvariable

235Gmostly conserved

325Amostly conserved

373Avariable

412Cmostly conserved

415Avariable

427Avariable

448Cvariable

478Cmostly conserved

514Amostly conserved

520Amostly conserved

535Cmostly conserved

550Amostly conserved

565Amostly conserved

571Tmostly conserved

583Avariable

604Amostly conserved

616Gmostly conserved

628Avariable

631Cvariable

CCTTTATCTTGTATTTGGTGCCTGAGCCGGAATGGTGGGGACTGCCCTAAGCCTCCTTATTCGGGCCGAACTAAGCCAACCTGGATCACT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes6

BINs3

Most divergent pair2.8%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Telestes beoticussame genus3.2%Telestes muticellussame genus4.6%Telestes montenigrinussame genus4.8%Telestes polylepissame genus5.1%Telestes metohiensissame genus5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P12S

animal barcodemarker

08Occurrence & distribution

Record type320 records

Wild obs. + sensor14

Museum / vouchered162

Other144

Range

Area of Occupancy AOO272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 5≤1 km 5>10 km 3

13 georeferenced · 1 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 162 records without

Open the institutions mapphysical evidence162

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bonn, DE	130
	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
National Museum of the Czech Republiclocation not on record	1

4 institutions · 136 of 162 vouchered records shown · 26 without an institution code

09Environmental DNA36 detections

Where the DNA of Telestes pleurobipunctatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.0 °C 12.5–17.1

Seasonal swing summer↔winter17.0 °C

Max temp (day)18.7 °C 16.3–21.0

Min temp (night)11.0 °C 7.70–14.9

Precipitation73.1 mm/mo 55.2–88.4

Air humidity59.2 % 58.0–62.8

Moisture balance-35.4 mm/mo -51.6–-17.6

Vapour deficit758 Pa 672–861

Wind speed3.00 m/s 2.40–4.30

Cloud cover38.3 % 36.0–40.1

CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)