Teesdalia nudicaulis
(L.) W.T.Aiton · speciesAt a glance
Occurrence records56 981
Data sources10
Biological traits47
DNA specimens28
eDNA detections19
Sources10 archives
Databases and archives Teesdalia nudicaulis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility56 981 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics28 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources47 traits
Occurrence & distributionGBIF56 981 records
Environmental DNA1 datasets · 4 countries19 detections
DNA & barcodingBOLD · NCBI28 specimens
Genome at a glanceCCDB · GoaT514 Mbp
01Narrative
Teesdalia nudicaulis, la Téesdalie à tige nue, est une espèce de plantes herbacées annuelles de la famille des Brassicaceae. Le nom du genre botanique Teesdalia (de) rend hommage au jardinier et botaniste anglais Robert Teesdale (de) (1740-1804).
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology12
Fruit length3.5 mm
Leaf length35 mm
Leaf mass3.92 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 104 mm² · GIFT: 104 mm²
Plant height0.127 m
⚠ sources differ — GIFT: 0.127 m · AusTraits: 0.115 m · LEDA: 0.08 m · TRY: 0.11 m
Plant height generative0.094 m
Plant height max0.2 m
Plant height min0.03 m
Seed length1.09 mm
Seed mass0.317 mg
⚠ sources differ — TRY: 0.317 mg · LEDA: 0.283 mg · GIFT: 0.299 mg
Seed mass max0.34 mg
Seed mass min0.28 mg
Life cycle & reproduction14
Deciduousnessdeciduous
Dehiscencedehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: anemochorous
Flowering endJun
Flowering startApr
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
⚠ sources differ — LEDA: Hemicryptophyte · GIFT: therophyte
Reproduction asexualabsent
Seed number140
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max100 m
Elevation min0 m
Epiphyteterrestrial
Fruit typesilique
⚠ sources differ — AusTraits: silique · GIFT: capsule
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: forb-annual
Habitat GIFTcrop fields, old fields, sand
Leaf compoundnesssimple
Woodinessnon-woody
Physiology & chemistry7
Leaf C:N ratio11.76 g/g
Leaf c422 mg/g
Leaf dry-matter content (LDMC)77.92 mg/g
⚠ sources differ — TRY: 77.92 mg/g · LEDA: 136 mg/g
Leaf n39.94 mg/g
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)17.57 mm²/mg
⚠ sources differ — TRY: 17.57 mm²/mg · LEDA: 28.95 mm²/mg · GIFT: 28.95 mm²/mg
Other traits1
Diaspore typeone-seeded generative dispersule
05DNA & barcoding28 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Teesdalia nudicaulis has left across the world's sequence archives.
At a glance
DNA specimens28
Marker genes5
GenBank sequences10
eDNA detections19
Countries5
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAAGCCTTCTGGCTGAGGGCACGTCTGCCTGGGTGTCACAAATC …
Teesdalia nudicaulis voucher CCDB-18327-B3 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL5★rbcLa★ITS2★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Teesdalia nudicaulis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size514 428 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Teesdalia nudicaulis0.51 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidy4× tetraploid · measured
Chromosome records18–362n range36median36mode32records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3631×GoaT · Kew Plant DNA C-values Database · CCDB · iber-fl · CCDB · nw-europe-fl +13
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · iber-fl — Chromosomenzahlen und hinweise auf systematik und verbreitung von Brasicaceae-arten aus Europa, Nordafrika, Asien und Australien. Polatschek, A.Phyton23(1): 127-139(1983).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Queirs, M.Bol. Soc. Brot. ser. 247: 315-335(1973).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2349
CCDB · fl-europaea — Lovkvist, 1963
CCDB · poland — Chojnacki, W., E. Charotyniuk & K. Bijok. 1979. Cyto-embriological studies on Teesdalea nudicaulis (L.) R. Br. from natural stands of western Pomerania. Zesz. Nauk. Wydz. Biol. Nauk Ziemi, Biol. 1: 11-123.
CCDB · book-ipcn65 — Larsen 1965b
CCDB · ipcn-api-dl — Polatschek, A. 1983. Chromosomenzahlen und hinweise auf systematik und verbreitung van Brassicaceae-Arten aus Europa, Nordafrika, Asien und Australien. Phyton (Horn). 23: 127–139.
CCDB · ipcn-api-dl — Chojnacki, W., E. Charytoniuk & K. Bijok. 1979. Cyto-embryological studies on Teesdalea nudicaulis (L.) R. Br. from natural stands of western Pomerania. Zesz. Nauk. Wydz. Biol. Nauk Ziemi, Biol. 1: 111–123.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Mĕsíček, J. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · book-ipcn67-71 — GADELLA, Th. W. J., & E. KLIPHUIS. 1966.' Chromosome numbers of flowering plants in the Netherlands II. Proc. Roy. Neth. Acad. Sci. Ser. C. 69: 541-556.
CCDB · book-northern-plants — Manton 1932 a, Jaretzky 1932.
CCDB · book-ipcn73-74 — QUEIROS, M. 1973. Contribuicao para o conhecimento citotaxonomico d~ Spermatophyta de Portugal. IX. Cruciferae. Bol. Soc. Brot. 47(Ser. 2 315 335. I
CCDB · eflora
CCDB · brass — Mescek
CCDB · brass — Bcher & Larsen
CCDB · brass — Larsen
CCDB · brass — Gadella & Kliphuis
CCDB · brass — Chojnacki et al.
CCDB · brass — Queirs
CCDB · brass — Manton
CCDB · brass — Polatschek
CCDB · brass — Lvkvist & Hultgrd
CCDB · book-atlas-flowering-plants — Manton 1932
CCDB · kew — Lysák MA, Koch MA, Beaulieu JM, Meister A, Leitch IJ. 2009. The dynamic ups and downs of genome size evolution in Brassicaceae. Molecular Biology and Evolution 26: 85-98.
CCDB · Cave1958 — Bocher & Larsen 1958
CCDB · CromoCat 2015 — Chojnacki, W., Charytoniuk, E. & Bijok, K. (1979). Cyto-embryological studies on Teesdalea nudicaulis (L.) R. Br. from natural stands of western Pomerania Zeszyty Naukowe Wydzialu Biologii i Nauk o Ziemi : Biologia 1: 111-123
CCDB · CromoCat 2015 — Lövkvist, B. & Hultgård, U.-M. (1999). Chromosome numbers in south Swedish vascular plants Opera botanica 137: 1-42
CCDB · CromoCat 2015 — Polatschek, A. (1983). Chromosomenzahlen und hinweise auf systematik und verbreitung von Brasicaceae-arten aus Europa, Nordafrika, Asien und Australien. Phyton (Horn) 23(1): 127-139.
CCDB · CromoCat 2015 — Queirós, M. (1973c). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. IX. Cruciferae. Bol. Soc. Brot. 47: 315-335.
2n 181×CCDB · brass
CCDB · brass — Bcher & Larsen
n 187×CCDB · ipcn-api-dl · CCDB · brass · CCDB · Cave1958 +1
CCDB · ipcn-api-dl — Chojnacki, W., E. Charytoniuk & K. Bijok. 1979. Cyto-embryological studies on Teesdalea nudicaulis (L.) R. Br. from natural stands of western Pomerania. Zesz. Nauk. Wydz. Biol. Nauk Ziemi, Biol. 1: 111–123.
CCDB · brass — Tischler
CCDB · brass — Rohweder
CCDB · brass — Jaretzky
CCDB · brass — Chojnacki et al.
CCDB · Cave1958 — Bocher & Larsen 1958
CCDB · CromoCat 2015 — Chojnacki, W., Charytoniuk, E. & Bijok, K. (1979). Cyto-embryological studies on Teesdalea nudicaulis (L.) R. Br. from natural stands of western Pomerania Zeszyty Naukowe Wydzialu Biologii i Nauk o Ziemi : Biologia 1: 111-123
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type56 981 records
Wild obs. + sensor53 953
Museum / vouchered3 002
Cultivated / captive21
Other5
Origin
Native3 059
Introduced7
Range
Area of Occupancy AOO70 900 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy50% within 1 km
≤100 m 15 199≤1 km 9 663≤10 km 24 859>10 km 300
50 021 georeferenced · 3 932 without coordinates
Open the mapobservation + sensor53 953
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy45% within 1 km
≤100 m 146≤1 km 668≤10 km 955>10 km 27
1 796 georeferenced · 1 206 without coordinates
Open the institutions mapphysical evidence3 002
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1>10 km 20
21 georeferenced
Open the mapnot free-living21
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions65 of 114 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 991 |
| LDlocation not on record | 433 |
| MeiseBGlocation not on record | 196 |
| Zürich, CH | 136 |
| Oskarshamn, SE | 129 |
| Zürich, CH | 115 |
| KMNlocation not on record | 100 |
| Olocation not on record | 97 |
| Williamsburg, US | 35 |
| Chapel Hill, US | 35 |
| Victoria, CA | 34 |
| South Kensington, GB | 34 |
| SLU Artdatabankenlocation not on record | 34 |
| Corvallis, US | 29 |
| Pullman, US | 25 |
| Vancouver, CA | 23 |
| WTUlocation not on record | 21 |
| Hobart, AU | 20 |
| PRClocation not on record | 17 |
| UGentlocation not on record | 17 |
| Uppsala, SE | 17 |
| Berlin, DE | 15 |
| BRNUlocation not on record | 13 |
| Bergen, NO | 12 |
| BIO-UNIPIlocation not on record | 10 |
| Badajoz, ES | 9 |
| Wlocation not on record | 9 |
| Philadelphia, US | 9 |
| Trondheim, NO | 8 |
| College Park, US | 8 |
| Bangkok, TH | 8 |
| Norfolk, US | 8 |
| Fulda, DE | 8 |
| Dover, US | 8 |
| DBF-NHMDlocation not on record | 8 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 7 |
| BSBIlocation not on record | 7 |
| Uniwersytet Warszawskilocation not on record | 6 |
| Columbia, US | 6 |
| DAOlocation not on record | 6 |
| Chongqing Museumlocation not on record | 5 |
| Canberra, AU | 5 |
| BClocation not on record | 5 |
| Tacoma, US | 5 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 5 |
| University of British Columbia, Herbariumlocation not on record | 5 |
| Karlsruhe, DE | 4 |
| Museo Entomologico de Leonlocation not on record | 4 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 4 |
| Paris, FR | 4 |
| New Haven, US | 4 |
| Wellington, NZ | 4 |
| Provincia di Livornolocation not on record | 4 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 4 |
| Salvador, BR | 4 |
| Fairfax, US | 4 |
| Moscow, US | 4 |
| Moscow State Universitylocation not on record | 3 |
| Pacific Lutheran Universitylocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Dresden, DE | 3 |
| CJBNlocation not on record | 3 |
| Tampa, US | 3 |
| University of Stellenboschlocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| GJOlocation not on record | 2 |
| Dekalb, US | 2 |
| BioFokuslocation not on record | 2 |
| Podgorica, ME | 2 |
| Xiamen, CN | 2 |
| UniKSlocation not on record | 2 |
| QVMAGlocation not on record | 2 |
| Boise, US | 2 |
| Pocatello, US | 2 |
| Santa Cruz, US | 2 |
| Clemson, US | 2 |
| Bloomington, US | 2 |
| Burlington, US | 2 |
| Oulu, FI | 1 |
| Santa Barbara, US | 1 |
| Christchurch, NZ | 1 |
| Durham, US | 1 |
| Logan, US | 1 |
| CASlocation not on record | 1 |
| New Brunswick, US | 1 |
| North Carolina Museum of Natural Scienceslocation not on record | 1 |
| China Agricultural Universitylocation not on record | 1 |
| Montréal, CA | 1 |
| Valdosta State Universitylocation not on record | 1 |
| BAYLUlocation not on record | 1 |
| Flagstaff, US | 1 |
| Adelaide, AU | 1 |
| Brisbane, AU | 1 |
| Monastir, TN | 1 |
| Riverside, US | 1 |
| Jackson, US | 1 |
| Due West, US | 1 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 1 |
| Henderson, US | 1 |
| NMBU:MINAlocation not on record | 1 |
| Whitehorse, CA | 1 |
| Wuzhou, CN | 1 |
| Knoxville, US | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| GZUlocation not on record | 1 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Mexico City, MX | 1 |
| TUR-Alocation not on record | 1 |
| Millersville, US | 1 |
| University of Southern Mississippilocation not on record | 1 |
| GAlocation not on record | 1 |
| Göteborg, SE | 1 |
| Saint Louis, US | 1 |
114 institutions · 2 863 of 3 002 vouchered records shown · 55 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA19 detections
Where the DNA of Teesdalia nudicaulis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found19
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 19 detections have coordinates
Open the map4 countries0
Garry Oak ecosystem
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median11.9 °C 9.00–13.6
Seasonal swing summer↔winter12.8 °C
Max temp (day)15.0 °C 10.6–17.2
Min temp (night)9.50 °C 6.90–11.2
Precipitation55.6 mm/mo 38.8–73.5
Air humidity61.6 % 60.3–63.2
Moisture balance-41.5 mm/mo
Vapour deficit535 Pa 445–600
Wind speed4.70 m/s
Cloud cover43.2 % 35.8–55.0
CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.