Tecticornia pergranulata

(J.M.Black) K.A.Sheph. & Paul G.Wilson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Amaranthaceae/Tecticornia

At a glance

Occurrence records2 019

Data sources8

Biological traits30

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Tecticornia pergranulata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 019 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources30 traits

Occurrence & distributionGBIF2 019 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Tecticornia pergranulata (commonly known as the blackseed glasswort or blackseed samphire) is a succulent halophytic plant species in the family Chenopodiaceae, native to Australia. This plant is commonly tested in labs involving its C3 photosynthesis and its unique resistance to salinity and adversity.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology10

Leaf length5 mm

Leaf width3 mm

Plant height1 m

⚠ sources differ — GIFT: 1 m · AusTraits: 0.5 m

Plant height max1 m

Plant height min0.15 m

Seed length1 mm

Seed mass0.69 mg

⚠ sources differ — TRY: 0.69 mg · AusTraits: 0.175 mg · GIFT: 0.69 mg

Seed mass max1.09 mg

Seed mass min0.29 mg

Seed width1 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeanimal

Flowering timennnyyyyyynnn

Life formsubshrub

Life spanperennial

Pollination syndromeabiotic

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: shrub · TRY: succulent

Leaf compoundnesssimple

Leaf shapeterete

Woodinessnon-woody

⚠ sources differ — TRY: non-woody · AusTraits: woody · GIFT: woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tecticornia pergranulata has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences9

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKU975212.1 ↗613 bpAustralia

ACGT

TCGAAACCTGCCCAGCAGATTGACCGGCGAACATGTTCATCATGCAGGGTTGGGGTGCTGGAGTGACCCACGGTTGCCAGCCCCCTTCCC …

Tecticornia pergranulata isolate Lab-No chen 3083 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★ITS6★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type2 019 records

Wild obs. + sensor1 572

Museum / vouchered427

Other20

Origin

Native325

Range

Area of Occupancy AOO3 384 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 1 337≤1 km 184≤10 km 34>10 km 4

1 559 georeferenced · 13 without coordinates

Open the mapobservation + sensor1 572

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 182≤1 km 102≤10 km 105>10 km 18

407 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence427

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	242
Brisbane, AU	51
Museo Entomologico de Leonlocation not on record	35
Canberra, AU	28
Kensington, AU	23
Mount Annan, AU	12
Parkville, AU	5
Stockholm, SE	3
Kew, GB	3
Hobart, AU	3
Palmerston, AU	3
BGPAlocation not on record	2
Smithfield, AU	2
John T. Waterhouse Herbariumlocation not on record	1

14 institutions · 413 of 427 vouchered records shown · 13 without an institution code

09Environmental DNA3 detections

Where the DNA of Tecticornia pergranulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Tecticornia pergranulata

At a glance

Sources8 archives

Size & morphology10

Life cycle & reproduction8

Diet & foraging1

Habitat & environment9

Physiology & chemistry2

At a glance

Record type2 019 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 019 records