Tecticornia lylei

(Ewart & Jean White) K.A.Sheph. & Paul G.Wilson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Amaranthaceae/Tecticornia

At a glance

Occurrence records338

Data sources6

Biological traits28

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Tecticornia lylei's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility338 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources28 traits

Occurrence & distributionGBIF338 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 18

01Narrative

Halosarcia lylei là loài thực vật có hoa thuộc họ Dền. Loài này được Paul G. Wilson mô tả khoa học đầu tiên năm 1980.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology9

Leaf length3 mm

Leaf width3 mm

Plant height1 m

Plant height max1 m

Plant height min0.25 m

Seed length1.25 mm

Seed mass0.462 mg

⚠ sources differ — TRY: 0.462 mg · AusTraits: 0.367 mg · GIFT: 0.51 mg

Seed mass max0.51 mg

Seed mass min0.51 mg

Life cycle & reproduction7

Dispersal typeanimal

Flowering timennnnnnnyyynn

Life formshrub

Life spanperennial

Pollination syndromewind

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: shrub · TRY: succulent

Leaf compoundnesssimple

Leaf shapeterete

Woodinessnon-woody

⚠ sources differ — TRY: non-woody · AusTraits: woody · GIFT: non-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tecticornia lylei has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOM445510.1 ↗536 bpAustralia

ACGT

CCCCTTCCCTGGCCTGGGGAGAGCACACCTTCGGGAGTGTCCCTACGGCATAATAACAAACCCCGGCGCAGTATGCGCCAAGGAATATCA …

Tecticornia lylei isolate chen 3367 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Tecticornia lylei carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Shepherd, K. A. & G. Yan. 2003. Chromosome number and size variations in the Australian Salicornioideae (Chenopodiaceae)---evidence of polyploidisation. Austral. J. Bot. 51: 441–452.

08Occurrence & distribution

Record type338 records

Wild obs. + sensor113

Museum / vouchered224

Cultivated / captive1

Origin

Native26

Range

Area of Occupancy AOO700 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 81≤1 km 8≤10 km 18>10 km 2

109 georeferenced · 4 without coordinates

Open the mapobservation + sensor113

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 50≤1 km 51≤10 km 84>10 km 8

193 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence224

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	78
Adelaide, AU	46
Museo Entomologico de Leonlocation not on record	45
Canberra, AU	21
Mount Annan, AU	10
Brisbane, AU	4
Kew, GB	3
Palmerston, AU	3
Hobart, AU	2
BGPAlocation not on record	2
Bronx, US	1
Stockholm, SE	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Joondalup, AU	1
Wlocation not on record	1

15 institutions · 219 of 224 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)