Tecomanthe speciosa

W.R.B.Oliv. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Bignoniaceae/Tecomanthe

At a glance

Occurrence records15

Data sources7

Biological traits7

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Tecomanthe speciosa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility15 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Occurrence & distributionGBIF15 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 38

01Narrative

Tecomanthe speciosa (also known as the Three Kings vine or akapukaea) is a species of subtropical forest lianes. A single specimen was first discovered on Manawatāwhi / Three Kings Islands, 55 km off the northern tip of New Zealand, during a scientific survey in 1945. No other specimens have ever been found in the wild. Tecomanthe is a tropical genus not otherwise represented in New Zealand. Four other species of Tecomanthe occur in Queensland, Indonesia, New Guinea, and the Solomon Islands.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Seed mass15.95 mg

Life cycle & reproduction1

Life formliana

Diet & foraging1

Parasiteindependent

Habitat & environment4

Climatewet tropical

Climberobligatory

Epiphyteterrestrial

Growth formclimber

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tecomanthe speciosa has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKT626789.1 ↗1 195 bpNew Zealand · 2015

ACGT

AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAGGATACTGATATCTTGGCAGC …

Tecomanthe speciosa voucher CHR:688788 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Tecomanthe speciosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Chromosome records38–382n range38median38mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 383×CCDB · new-zealand · CCDB · book-fedorov · CCDB · Cave1963

CCDB · new-zealand

CCDB · book-fedorov — Beuzenberg, Hair 1963

CCDB · Cave1963 — Beuzen. & Hair 1963

n 191×CCDB · Cave1963

CCDB · Cave1963 — Beuzen. & Hair 1963

08Occurrence & distribution

Record type15 records

Wild obs. + sensor6

Museum / vouchered8

Cultivated / captive1

Range

Area of Occupancy AOO48 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 3>10 km 2

5 georeferenced · 1 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence8

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	4
Hobart, AU	2
Rotorua, NZ	1
Smithfield, AU	1

4 institutions · 8 of 8 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)