Tecoma stans
(L.) Juss. ex Kunth · speciesAt a glance
Occurrence records22 517
Data sources15
Biological traits140
DNA specimens34
eDNA detections19
Sources15 archives
Databases and archives Tecoma stans's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility22 517 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics34 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources140 traits
Chemical compositionLOTUS · NPASS116 compounds
Occurrence & distributionGBIF22 517 records
Environmental DNA1 datasets · 6 countries19 detections
DNA & barcodingBOLD · NCBI34 specimens
Genome at a glanceCCDB · GIFT · GoaT626 Mbp
01Narrative
Tecoma stans, communément appelé Bois pissenlit, Bois Caraïbes ou Trompette d'or, est une espèce de plantes à fleurs de la famille des Bignoniaceae. C'est un arbuste tropical originaire d'Amérique.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsUSDATRY
Size & morphology25
Fruit length160 mm
Fruit length max210 mm
Fruit length min70 mm
Fruit width14.5 mm
Fruit width max8 mm
Fruit width min7 mm
Leaf length90 mm
Leaf length max250 mm
Leaf length min24 mm
Leaf width19 mm
Leaf width max30 mm
Leaf width min8 mm
Petiole length3.5 cm
Plant height6.05 m
⚠ sources differ — GIFT: 6.05 m · AusTraits: 4.5 m · USDA: 6.1 m · TRY: 6.1 m
Plant height max10 m
Plant height min2 m
Seed length20 mm
Seed length max8 mm
Seed length min3 mm
Seed mass7.41 mg
⚠ sources differ — TRY: 7.41 mg · GIFT: 6.05 mg
Seed mass max12.7 mg
Seed mass min4.85 mg
Seed width6 mm
Seed width max27 mm
Seed width min24 mm
Life cycle & reproduction35
Bloom periodIndeterminate
Coppice potentialYes
Deciduousnessevergreen
Dehiscencedehiscent
Dispersal typewind
Flower colouryellow
Flower conspicuousYes
Flower length max85 mm
Flower length min35 mm
Flowering endDec
Flowering startApr
Flowering timennnnnnnnnnyn
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDARapid
Life formtree
Life spanperennial
Lifespan categoryModerate
Pollination modebiotic
Pollination syndrome detailedbee
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsYes
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formphanerophyte
Resprout abilityYes
Seed spread rateNone
Seedling vigorHigh
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment34
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatewet tropical
Climberself-supporting
Elevation max2 800 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureFine
Fruit colourbrown
Fruit fleshinessdry
Fruit typecapsule
Growth formshrub
⚠ sources differ — GIFT: shrub · AusTraits: shrub tree · TRY: Shrub
Growth form USDAMultiple Stem
Habitat GIFTÁrea Antrópica, Carrasco, Cerrado (lato sensu)
Hedge toleranceMedium
Known allelopathNo
Leaf compoundnesscompound
Leaf formimparipinnate
Leaf retentionNo
Leaf shapelanceolate ovate
Low growing grassNo
Mycorrhiza type0.000000000788
Root depth min12 in
Shape and orientationErect
Small grainNo
Succulenceno
Woodinesswoody
Physiology & chemistry22
Anaerobic toleranceNone
C:N ratioHigh
Caco3 toleranceHigh
Cold stratification requiredNo
Drought toleranceHigh
Fertility requirementLow
Fire resistantNo
Fire toleranceMedium
Frost free days min200 days
Moisture useLow
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max40 in
Precipitation min10 in
Protein potentialLow
Salinity toleranceNone
Shade toleranceHigh
Soil pH max8 pH
Soil pH min6.5 pH
Temperature min17 °F
Wood density467 mg/cm³
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productYes
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound100 000 per lb
ToxicityNone
Veneer productNo
Other traits8
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousYes
Fruit seed persistenceNo
Height at 20yr6.1 m
Leaf arrangementopposite
Planting density max2 500 per acre
Planting density min700 per acre
03Chemical composition116 compounds
Compounds documented for Tecoma stans across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Labdane diterpenoids9
Cinnamic acids and derivatives8
Terpenoid alkaloids8
Iridoids monoterpenoids5
Labdane diterpenoids $ Norlabdane diterpenoids5
Documented compounds116 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Ursolic Acid | present | LOTUS | |
| (1R,4As,8Ar)-5,5,8A-Trimethyl-4-Oxo-1-[(E)-2-(5-Oxo-2H-Furan-4-Yl)Ethenyl]-4A,6,7,8-Tetrahydro-1H-Naphthalene-2-Carbaldehyde | present | NPASS | |
| (2R,3S,4R,5R)-2,3,4,5,6-pentahydroxyhexanal | present | LOTUS | |
| (2S,4aS,4bR,6aS,12bS,12cS,14aS)-3,4,4a,4b,5,6,6a,7,12,12b,12c,13,14,14a-Tetradecahydro-alpha,alpha,4a,12b,12c-pentamethyl-2H-1-benzopyrano(5',6':6,7)indeno(1,2-b)indole-2-methanol | present | NPASS | |
| (3E,5R)-3-[2-[(1S,4aS,8aS)-5,5,8a-trimethyl-2-methylidene-3,4,4a,6,7,8-hexahydro-1H-naphthalen-1-yl]ethylidene]-5-hydroxyoxolan-2-one | present | NPASS | |
| (3S,6E)-Nerolidol | present | NPASS | |
| (4R,4aS,7R,7aR)-2,4,7-trimethyl-3,4,5,6,7,7a-hexahydro-1H-cyclopenta[c]pyridin-4a-ol | present | LOTUS | |
| (4R,6R,7S,7aS)-2,4,7-trimethyl-1,3,4,6,7,7a-hexahydrocyclopenta[c]pyridin-6-ol | present | LOTUS | |
| (4R,7S,7aS)-1,2,3,4,7,7a-Hexahydro-2,4,7-trimethyl-6H-cyclopenta(c)pyridin-6-one | present | LOTUS | |
| (4S,4aR,7R,7aR)-2,4,7-trimethyl-3,4,5,6,7,7a-hexahydro-1H-cyclopenta[c]pyridin-4a-ol | present | LOTUS |
05DNA & barcoding34 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tecoma stans has left across the world's sequence archives.
At a glance
DNA specimens34
Marker genes7
GenBank sequences9
eDNA detections19
Countries7
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCTCGCATC …
Tecoma stans voucher MO:Carlsen3287 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL2★rbcLa★ITS6★ITS2matRtrnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT · GoaT
The complete instruction manual Tecoma stans carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size625 920 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Tecoma stans0.63 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidy2× diploid · measured
Chromosome records36–402n range36median36mode14records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 369×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-indian_vol1 +2
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ipcn-api-dl — Piazzano, M. 1998. Números cromosómicos en Bignoniaceae de Argentina. Kurtziana 26: 179–189.
CCDB · ipcn-api-dl — Goldblatt, P. & A. H. Gentry. 1979. Cytology of Bignoniaceae. Bot. Not. 132: 475–482.
CCDB · book-indian_vol1 — Mehra, P.N. & Singh, A 1963; Sanjappa, M. & Sathyananda, N. 1979
CCDB · kew — Ohri D. (pers. comm. 2002).
GIFT · GIFT (floras)
2n 405×CCDB · book-indian_vol1 · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants +1
CCDB · book-indian_vol1 — Venkatasubban, K.R. 1944
CCDB · book-indian_vol1 — Bowden, W.M. 1940a, 1945a
CCDB · book-fedorov — Venkatasubban 1944 .
CCDB · book-atlas-flowering-plants — Bowden 1945a
GIFT · GIFT (floras)
n 184×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Bir, S. S. & G. S. Chattha. 1983. SOCGI plant chromosome number reports -- I. J. Cytol. Genet. 18: 56–58.
CCDB · ipcn-api-dl — Sandhu, P. S. & S. K. Mann. 1988. SOCGI plant chromosome number reports -- VII. J. Cytol. Genet. 23: 219–228.
CCDB · ipcn-api-dl — Goldblatt, P. & A. H. Gentry. 1979. Cytology of Bignoniaceae. Bot. Not. 132: 475–482.
CCDB · ipcn-api-dl — Ward, D. E. 1984. Chromosome counts from New Mexico and Mexico. Phytologia 56(1): 55–60.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid2×GoaT · Kew Plant DNA C-values Database · GIFT · GIFT (floras)
GoaT · Kew Plant DNA C-values Database
GIFT · GIFT (floras)
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type22 517 records
Wild obs. + sensor18 023
Museum / vouchered4 451
Cultivated / captive24
Other19
Origin
Native83
Introduced997
Range
Area of Occupancy AOO46 704 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy82% within 1 km
≤100 m 8 293≤1 km 1 648≤10 km 1 548>10 km 619
12 108 georeferenced · 5 915 without coordinates
Open the mapobservation + sensor18 023
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy85% within 1 km
≤100 m 1 527≤1 km 177≤10 km 220>10 km 87
2 011 georeferenced · 2 440 without coordinates
Open the institutions mapphysical evidence4 451
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy100% within 1 km
≤100 m 1≤1 km 1
2 georeferenced · 22 without coordinates
Open the mapnot free-living24
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions155 of 337 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Durango, MX | 734 |
| Mexico City, MX | 367 |
| Saint Louis, US | 316 |
| Austin, US | 191 |
| Chicago, US | 97 |
| Bronx, US | 89 |
| Ciudad de México, MX | 87 |
| ASUlocation not on record | 78 |
| Chapingo, MX | 70 |
| Guasave, MX | 68 |
| Mexico City, MX | 61 |
| Riverside, US | 49 |
| National Biodiversity Institute, Costa Ricalocation not on record | 49 |
| Juriquilla, MX | 47 |
| Tampa, US | 46 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 45 |
| EL PASO, US | 39 |
| Austin, US | 36 |
| Tapachula, MX | 36 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 36 |
| La Paz, MX | 35 |
| Mérida, MX | 31 |
| Antiguo Cuscatlán, SV | 31 |
| University of Stellenboschlocation not on record | 27 |
| Tuxtla Gutiérrez, MX | 27 |
| Universidad Nacional de Colombia (UNAL)location not on record | 26 |
| Puebla, MX | 26 |
| Mexico City, MX | 25 |
| Mérida, MX | 24 |
| Berlin, DE | 24 |
| Kew, GB | 24 |
| Loja, EC | 24 |
| Guatemala, GT | 23 |
| Miami, US | 22 |
| San Isidro, AR | 22 |
| Phoenix, US | 22 |
| Santa Cruz de la Sierra, BO | 21 |
| Universidad de Caldas (UCaldas)location not on record | 21 |
| Canberra, AU | 20 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 19 |
| MEXUlocation not on record | 18 |
| Zacatecas, MX | 18 |
| Xiamen, CN | 17 |
| MeiseBGlocation not on record | 17 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 17 |
| Córdoba, AR | 17 |
| Lubbock, US | 17 |
| Istituto Agrario Castelnuovolocation not on record | 16 |
| Porto Alegre, BR | 16 |
| Mount Annan, AU | 15 |
| Jardín Botanico de Bogotá José Celestino Mutis (JBB)location not on record | 15 |
| San Angelo, US | 15 |
| Tlalnepantla, MX | 14 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 14 |
| Universidade Federal do Maranhãolocation not on record | 13 |
| MAlocation not on record | 13 |
| Universidad Industrial de Santander (UIS)location not on record | 13 |
| Wuzhou, CN | 13 |
| Tuxtla Gutiérrez, MX | 13 |
| Maringá, BR | 13 |
| UFMSlocation not on record | 12 |
| Universidad de Antioquia (UdeA)location not on record | 12 |
| Chongqing Museumlocation not on record | 12 |
| USP-IBlocation not on record | 12 |
| UTFPR-CPlocation not on record | 12 |
| St. Augustine, TT | 11 |
| Pondicherry, IN | 11 |
| Palmerston, AU | 11 |
| Auckland, NZ | 11 |
| Altos de Pipe, VE | 11 |
| Guatemala City, GT | 11 |
| PUC-RSlocation not on record | 10 |
| Ivano-Frankivsk, UA | 10 |
| Museo Entomologico de Leonlocation not on record | 10 |
| Adelaide, AU | 10 |
| Baroda, IN | 10 |
| Culiacán, MX | 10 |
| Claremont, US | 10 |
| Campo Mourão, BR | 10 |
| UnBlocation not on record | 10 |
| Laboratorio de Ictiologialocation not on record | 10 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 9 |
| Departamento de Sistematica e Ecologialocation not on record | 9 |
| Laboratory of Palaeontologylocation not on record | 9 |
| UNESP-ISlocation not on record | 9 |
| San José, CR | 9 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 9 |
| Bloomington, US | 9 |
| Cascavel, BR | 9 |
| Honolulu, US | 9 |
| Hermosillo, MX | 8 |
| UEMAlocation not on record | 8 |
| QAUlocation not on record | 8 |
| Ann Arbor, US | 8 |
| UEMlocation not on record | 8 |
| Fort Worth, US | 8 |
| Adam Mickiewicz University in Poznańlocation not on record | 8 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 8 |
| San Diego, US | 8 |
| Centro Cultural Santo Domingolocation not on record | 8 |
| JBRJlocation not on record | 8 |
| Smithfield, AU | 7 |
| Aarhus, DK | 7 |
| Universidad de La Salle (La Salle)location not on record | 7 |
| Paris, FR | 7 |
| Cenargenlocation not on record | 7 |
| Brasília, BR | 7 |
| Chaguaramas, TT | 7 |
| La Paz, BO | 7 |
| BISHlocation not on record | 7 |
| Autlán de Navarro, MX | 7 |
| Blumenau, BR | 7 |
| Uniwersytet Śląski w Katowicachlocation not on record | 7 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 7 |
| Corrientes, AR | 6 |
| UNIVASFlocation not on record | 6 |
| UNESP-RClocation not on record | 6 |
| UFRPElocation not on record | 6 |
| HNBlocation not on record | 6 |
| Universidade Federal de Sergipe (UFS)location not on record | 6 |
| FUVATESlocation not on record | 6 |
| The University of Arizonalocation not on record | 6 |
| Pretoria, ZA | 6 |
| Giardini Botanici Hanburylocation not on record | 6 |
| Masindi, UG | 6 |
| Santa Teresa, BR | 6 |
| Mexico City, MX | 6 |
| INMAlocation not on record | 6 |
| UTPLlocation not on record | 6 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 5 |
| Jataí / Setor Industrial, BR | 5 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 5 |
| IFAN Ch. A. Dioplocation not on record | 5 |
| Flagstaff, US | 5 |
| Toluca, MX | 5 |
| Yaoundé, CM | 5 |
| Santiago de Cali, CO | 5 |
| TAFORI-LSRClocation not on record | 5 |
| Sucre, BO | 5 |
| Edinburgh, GB | 4 |
| San Luis Obispo, US | 4 |
| Université de Strasbourglocation not on record | 4 |
| Bangkok, TH | 4 |
| Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record | 4 |
| UESBlocation not on record | 4 |
| INBIOlocation not on record | 4 |
| Cambridge, US | 4 |
| HEMlocation not on record | 4 |
| UNICAMPlocation not on record | 4 |
| Feira de Santana, BR | 4 |
| Stockholm, SE | 4 |
| Albuquerque, US | 4 |
| Kensington, AU | 4 |
| Universidad Católica de Oriente (UCO)location not on record | 4 |
| Quito, EC | 4 |
| UNESP-FCAVlocation not on record | 4 |
| UFBAlocation not on record | 4 |
| LDlocation not on record | 3 |
| Lake Charles, US | 3 |
| Salvador, BR | 3 |
| San Francisco, US | 3 |
| Leiden University Medical Centerlocation not on record | 3 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 3 |
| QCNElocation not on record | 3 |
| Christchurch, NZ | 3 |
| CEPLAClocation not on record | 3 |
| FUNEDlocation not on record | 3 |
| BMlocation not on record | 3 |
| Ilhéus, BR | 3 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 3 |
| Durban, ZA | 3 |
| CASlocation not on record | 3 |
| Fredericksburg, US | 3 |
| Montréal, CA | 3 |
| San Jose, US | 3 |
| NO DISPONIBLElocation not on record | 3 |
| BAYLUlocation not on record | 3 |
| Rotorua, NZ | 3 |
| UFMGlocation not on record | 3 |
| South Kensington, GB | 3 |
| Herbario de la Universidad Técnica del Nortelocation not on record | 3 |
| Universidade de São Paulolocation not on record | 3 |
| Sri Ramaswamy Memorial Universitylocation not on record | 3 |
| CJBGlocation not on record | 3 |
| UFSCarlocation not on record | 2 |
| Castelar, AR | 2 |
| Elocation not on record | 2 |
| Cochabamba, BO | 2 |
| Dekalb, US | 2 |
| IPA/SPlocation not on record | 2 |
| John T. Waterhouse Herbariumlocation not on record | 2 |
| Brasília, BR | 2 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 2 |
| RBGlocation not on record | 2 |
| Burlington, US | 2 |
| Stellenbosch University, DST- NRF Centre of Excellence for Invasion Biologylocation not on record | 2 |
| Taipei, TW | 2 |
| Bogotá, D.C., CO | 2 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 2 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 2 |
| UNESP, Campus São José Rio Prêtolocation not on record | 2 |
| Federal University of Espírito Santolocation not on record | 2 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 2 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 2 |
| WTUlocation not on record | 2 |
| Toronto, CA | 2 |
| CNF-UFHBlocation not on record | 2 |
| Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record | 2 |
| Universidad de Valparaísolocation not on record | 2 |
| Foz do Iguaçu, BR | 2 |
| University of Zhejianglocation not on record | 2 |
| Paleontological Collectionlocation not on record | 2 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 2 |
| Texas Lutheran Universitylocation not on record | 2 |
| Ciudad Juárez, MX | 2 |
| Mazatlán, MX | 2 |
| Beijing, CN | 2 |
| Irvine, US | 2 |
| Teresina, BR | 2 |
| Linares, MX | 2 |
| Ensenada, MX | 2 |
| Anchorage, US | 2 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 2 |
| University of Hamburglocation not on record | 2 |
| Waverly, US | 2 |
| UFPElocation not on record | 2 |
| UNEMATlocation not on record | 2 |
| Arizona State University Biocollectionslocation not on record | 2 |
| HUENFlocation not on record | 2 |
| UFVJMlocation not on record | 2 |
| Armidale, AU | 2 |
| UFESlocation not on record | 2 |
| San Luis Potosí, MX | 2 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 2 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 2 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 2 |
| UFAClocation not on record | 1 |
| UNESP-FCAlocation not on record | 1 |
| San Francisco de Campeche, MX | 1 |
| Pullman, US | 1 |
| Wlocation not on record | 1 |
| Chicago, US | 1 |
| Madison, US | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| Clemson, US | 1 |
| Facultad de Ingeniería en Tecnología de la Madera, Universidad Michoacana de San Nicolás de Hidalgolocation not on record | 1 |
| OTSlocation not on record | 1 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 1 |
| US | 1 |
| Universidad Nacional de La Patagonialocation not on record | 1 |
| UERJlocation not on record | 1 |
| UFPRlocation not on record | 1 |
| Philadelphia, US | 1 |
| UC_PESHlocation not on record | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| Tepatitlán de Morelos, MX | 1 |
| Gump Stationlocation not on record | 1 |
| Morelia, MX | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| Uppsala, SE | 1 |
| California Academy of Scienceslocation not on record | 1 |
| Orto botanico dell'Università degli Studi di Catanialocation not on record | 1 |
| UFABClocation not on record | 1 |
| Göteborg, SE | 1 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 1 |
| MSB-2797location not on record | 1 |
| Provincia di Livornolocation not on record | 1 |
| arosemena tola, EC | 1 |
| Escuela Agrícola Panamericanalocation not on record | 1 |
| GB | 1 |
| Minia, EG | 1 |
| Provo, US | 1 |
| Karlsruhe, DE | 1 |
| UEGlocation not on record | 1 |
| Cape Town, ZA | 1 |
| Ojo, NG | 1 |
| Universidad de Nariño (UdeNar)location not on record | 1 |
| FLASlocation not on record | 1 |
| University of Hargeisalocation not on record | 1 |
| US | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| DEAL Martiniquelocation not on record | 1 |
| University of Johannesburglocation not on record | 1 |
| Sociedad Para el Estudio de los Recursos Bioticos de Oaxacalocation not on record | 1 |
| UFSMlocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Millersville, US | 1 |
| Herbario MAT de la Universidad Politécnica Estatal del Carchilocation not on record | 1 |
| Cuenca, EC | 1 |
| Riobamba, EC | 1 |
| Dresden, DE | 1 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 1 |
| Davis, US | 1 |
| IAvHlocation not on record | 1 |
| Knox Collegelocation not on record | 1 |
| Natural History Museum of Jamaica (NHMJ)location not on record | 1 |
| Anton de Kom University of Surinamelocation not on record | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| Alexandria Universitylocation not on record | 1 |
| Universidad del Tolima (UT)location not on record | 1 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 1 |
| TAIElocation not on record | 1 |
| XALlocation not on record | 1 |
| Smithsonian Institution, National Museum of Natural Historylocation not on record | 1 |
| Universiti Sains Malaysialocation not on record | 1 |
| National Museums of Kenyalocation not on record | 1 |
| Cusco, PE | 1 |
| Museo de Historia Natural de El Salvadorlocation not on record | 1 |
| UFOPlocation not on record | 1 |
| CIIDIRlocation not on record | 1 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 1 |
| Universidad del Quindío (UniQuindío)location not on record | 1 |
| LSFlocation not on record | 1 |
| Columbia, US | 1 |
| CMULlocation not on record | 1 |
| Pomona Collegelocation not on record | 1 |
| San Juan College School of Science Math & Engineeringlocation not on record | 1 |
| Mississippi State, US | 1 |
| BGPAlocation not on record | 1 |
| Carter County Museumlocation not on record | 1 |
| Henderson, US | 1 |
| UFSClocation not on record | 1 |
| Universidad Autónoma de Guadalajaralocation not on record | 1 |
| Universidade Federal do Vale do São Franciscolocation not on record | 1 |
| UFRRJlocation not on record | 1 |
| URCAlocation not on record | 1 |
| Santarém, BR | 1 |
| Seropédica, BR | 1 |
| Cruz das Almas, BR | 1 |
| UEPAlocation not on record | 1 |
| Universidade Federal de Goiáslocation not on record | 1 |
| ESALQlocation not on record | 1 |
| Centro de Investigaciones Biológicas, Universidad Autónoma del Estado de Hidalgolocation not on record | 1 |
| UTFPR-SLlocation not on record | 1 |
| Zapopan, MX | 1 |
| Whitewater, US | 1 |
337 institutions · 4 323 of 4 451 vouchered records shown · 128 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA19 detections
Where the DNA of Tecoma stans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found19
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 19 detections have coordinates
Open the map6 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median19.6 °C 15.9–25.1
Seasonal swing summer↔winter15.1 °C
Max temp (day)25.6 °C 20.2–30.5
Min temp (night)14.5 °C 10.0–20.4
Precipitation44.5 mm/mo 4.50–117
Air humidity52.6 % 51.6–64.5
Moisture balance-50.3 mm/mo
Vapour deficit1,007 Pa 698–1,616
Wind speed2.20 m/s
Cloud cover25.2 % 14.7–27.0
CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.