Taxus mairei

(Lemée & Lév.) S.Y.Hu ex T.S.Liu · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Pinopsida/Pinales/Taxaceae/Taxus

At a glance

Occurrence records61

Data sources10

Biological traits10

DNA specimens49

eDNA detections72

Sources10 archives

Databases and archives Taxus mairei's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility61 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI72 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics49 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS · NPASS161 compounds

Occurrence & distributionGBIF61 records

Environmental DNA2 datasets · 2 countries72 detections

DNA & barcodingBOLD · NCBI49 specimens

01Narrative

Taxus mairei, Maire's yew, is a species of conifer in the yew family Taxaceae, native to Nepal, Assam, central and southern China, Hainan, Taiwan and Vietnam. It is extensively harvested for its paclitaxel (taxol) content in China.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction4

DeciduousnessEvergreen broad-leaved

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

03Chemical composition161 compounds

Compounds documented for Taxus mairei across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Taxane diterpenoids26

Taxane diterpenoids $ Tetracyclic diterpenoids9

Isocoumarins6

Pimarane and Isopimarane diterpenoids3

Podocarpane diterpenoids2

Documented compounds161 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Sandaracopimaric acid	present	NPASS
(2S,4aS,10aR)-2,6-dihydroxy-1,1,4a-trimethyl-7-propan-2-yl-3,4,10,10a-tetrahydro-2H-phenanthren-9-one	present	NPASS
(3R)-8-hydroxy-3-methyl-1-oxo-3,4-dihydroisochromene-5-carbaldehyde	present	NPASS
(3S)-8-hydroxy-3-methyl-1-oxo-isochromane-5-carboxylic acid	present	NPASS
(5R)-5-hydroxy-4-methoxy-5-prop-1-en-2-ylfuran-2-one	present	NPASS
(7R)-7-Hydroxylariciresinol	present	NPASS
1-Hydroxybaccatin I	present	NPASS
10-deacetylbaccatin III	present	NPASS
13-O-Deacetyltaxumairol Z	present	NPASS
19-hydroxybaccatin III	present	LOTUS

05DNA & barcoding49 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Taxus mairei has left across the world's sequence archives.

At a glance

DNA specimens49

Marker genes4

GenBank sequences10

eDNA detections72

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLPV751057.1 ↗128 567 bp

ACGT

TACTTTTTTATATCTAAGAAATCCATGTATAATACATAATAAAAAAAATATATATAGAAGTATACTTCTATATATATATTTTTTTCCACT …

Taxus mairei isolate QYT06 chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL10★ITS★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type61 records

Wild obs. + sensor25

Museum / vouchered36

Range

Area of Occupancy AOO184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 25

25 georeferenced

Open the mapobservation + sensor25

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence36

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kunming, CN	26
Taipei, TW	3
Nanjing, CN	2
Taipei, TW	2
Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record	1
Philadelphia, US	1

6 institutions · 35 of 36 vouchered records shown · 1 without an institution code

09Environmental DNA72 detections

Where the DNA of Taxus mairei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found72

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 72 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH8.50 7.80–9.20

Conductivity3,299 µS/cm 398–6,200

Organic carbon0.134 % 0.122–0.147

Water content5.93 % 5.14–6.72

Phosphorus16.1 mg/kg 9.50–22.7

Sand75.5 % 68.4–82.6

Depth0 m

SoilLatLon out of range

2 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.0 °C -0.6–27.3

Seasonal swing summer↔winter17.4 °C

Max temp (day)25.2 °C 0.7–30.6

Min temp (night)16.4 °C -3.00–23.4

Precipitation99.3 mm/mo 12.1–244

Air humidity59.8 % 51.9–63.3

Moisture balance91.8 mm/mo

Vapour deficit1000 Pa 281–1,349

Wind speed4.00 m/s

Cloud cover50.9 % 37.2–54.6

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)