Taxus floridana

Nutt. ex Chapm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Pinopsida/Pinales/Taxaceae/Taxus

At a glance

Occurrence records146

Data sources9

Biological traits11

DNA specimens4

eDNA detections4

Sources9 archives

Databases and archives Taxus floridana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility146 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Chemical compositionLOTUS20 compounds

Occurrence & distributionGBIF146 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Тис флоридский — редчайший вид тиса. Растения данного вида обнаружены лишь во Флориде на восточном берегу реки Апалачикола на участках площадью всего около 10 км² на высоте 15-30 м над уровнем моря. Вид находится под критической угрозой исчезновения. Это единственный вид тиса, произрастающий во Флориде. Тис флоридский представляет собой кустарник или дерево высотой около 6 м, реже — до 10 м. Диаметр ствола — 35-40 см, кора тонкая, чешуйчатая, коричневая, хвоя длиной до 2 см, толщиной 1-2 мм, семена имеют форму эллипса, длиной 5-6 мм, шишки похожи на ягоды. Долгое время тис флоридский считался подвидом тиса канадского, но растёт медленнее и имеет меньшие размеры. Тис флоридский, как и остальные тисы, ядовит, кора содержит паклитаксел, используемый в медицинских препаратах. Растения предпочитают кислые почвы и полутень.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Plant height8.33 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

03Chemical composition20 compounds

Compounds documented for Taxus floridana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Taxane diterpenoids8

Taxane diterpenoids $ Tetracyclic diterpenoids4

Abeotaxane diterpenoids $ Taxane diterpenoids2

Arylnaphthalene and aryltetralin lignans1

Stigmastane steroids1

Documented compounds20 total

Tissue Source Quantified only

Compound	Amount	Source
(2,4,9,15-Tetraacetyloxy-11-hydroxy-10,14,17,17-tetramethyl-6-oxatetracyclo[11.3.1.03,10.04,7]heptadec-13-en-12-yl) benzoate	present	LOTUS
(2E)-3-(2,6-dimethoxyphenyl)acrylaldehyde	present	LOTUS
(alphaR)-4-Hydroxy-alpha-methylbenzenepropanol	present	LOTUS
10-deacetylbaccatin III	present	LOTUS
3-(2,6-Dimethoxyphenyl)prop-2-enal	present	LOTUS
6,10-Methanobenzocyclodecene-3,8,11,12-tetrol, 1,2,3,4,4a,5,6,7,8,11,12,12a-dodecahydro-9,12a,13,13-tetramethyl-4-methylene-, 3,8,11,12-tetraacetate, (3S,4aR,6R,8S,11R,12R,12aR)-	present	LOTUS
[(1R,2R,3S,4S,7R,9R,10S,11S,12R,15R)-2,4,9,15-tetraacetyloxy-11-hydroxy-10,14,17,17-tetramethyl-6-oxatetracyclo[11.3.1.03,10.04,7]heptadec-13-en-12-yl] benzoate	present	LOTUS
[(1R,2S,3S,5S,8R,9R,10S,11S,13R,16S)-2,11,16-triacetyloxy-5,8-dihydroxy-3-(2-hydroxypropan-2-yl)-6,10-dimethyl-14-oxatetracyclo[8.6.0.03,7.013,16]hexadec-6-en-9-yl] benzoate	present	LOTUS
[(1R,2S,3S,5S,8R,9R,10S,11S,13R,16S)-2,5,11,16-tetraacetyloxy-8-hydroxy-3-(2-hydroxypropan-2-yl)-6,10-dimethyl-14-oxatetracyclo[8.6.0.03,7.013,16]hexadec-6-en-9-yl] benzoate	present	LOTUS
[(1S,2R,3R,4S,7R,9S,10S,11R,12R,15S)-2,4,9,11,12-pentaacetyloxy-10,14,17,17-tetramethyl-6-oxatetracyclo[11.3.1.03,10.04,7]heptadec-13-en-15-yl] acetate	present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Taxus floridana has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences10

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMH390474.1 ↗129 567 bp

ACGT

TTAGCCGTCTATAGAATTAGCTTCAACAGCAGCTAGATCCAGAGGGAAGTTGTGAGCGTTACGTTCGTGCATAACTTCCATACCAAGGTT …

Taxus floridana isolate 05 chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK6★rbcL4★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type146 records

Wild obs. + sensor76

Museum / vouchered70

Range

Area of Occupancy AOO312 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 76

76 georeferenced

Open the mapobservation + sensor76

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 4>10 km 18

22 georeferenced · 48 without coordinates

Open the institutions mapphysical evidence70

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Jena Microbial Resource Collectionlocation not on record	20
Miami, US	18
Kew, GB	5
Tall Timbers Research Stationlocation not on record	5
Edinburgh, GB	5
Paris, FR	4
Wuzhou, CN	3
University of Stellenboschlocation not on record	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
LDlocation not on record	2
Wlocation not on record	1
Auckland, NZ	1
Bangkok, TH	1

13 institutions · 70 of 70 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Taxus floridana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)