Taxus chinensis

(Pilg.) Rehd. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Pinopsida/Pinales/Taxaceae/Taxus

At a glance

Occurrence records427

Data sources6

Biological traits15

DNA specimens8

eDNA detections82

Sources6 archives

Databases and archives Taxus chinensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility427 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI82 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF427 records

Environmental DNA2 datasets · 3 countries82 detections

DNA & barcodingBOLD8 specimens

Genome at a glanceGoaT7.6 Gbp

01Narrative

Taxus calcicola — вид хвойних дерев родини Podocarpaceae. Батьківщиною цього виду є Китай і пд. В'єтнам.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Plant height30 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatetemperate

Climberself-supporting

Elevation max3 000 m

Elevation min2 000 m

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · TRY: shrub/tree

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry1

Wood density602 mg/cm³

⚠ sources differ — TRY: 602 mg/cm³ · GIFT: 761 mg/cm³

03Chemical composition4 compounds

Compounds documented for Taxus chinensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Taxane diterpenoids4

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
2-Deacetoxytaxinine J	present	LOTUS
CID 124511123	present	LOTUS
Taxezopidine G	present	LOTUS
Taxinine B	present	LOTUS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Taxus chinensis has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes2

eDNA detections82

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P1 572 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.17%

Haplotypes1

BINs0

Where individuals differ — all 4 variable positions, in barcode order

141Cvariable

143Avariable

160Avariable

173Avariable

ACGACACATAATTTGGTTCGATGGCTGTTCCCCACTAACCACAAGGATATAGGGACTCTCCATTCAATCTTCGGTGCCGTTGCTGGAGTG …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS

animal barcodefungal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_069591 ↗ · 32 protein · 10 tRNA · 5 rRNA

nad7nad2mttBrps13rps19rps3rpl16nad6nad4atp1cox2nad1nad3rps12rps4ccmFcccmFnatp6atp4nad5cox1ccmCnad9sdh4cox3atp8+9

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT

The complete instruction manual Taxus chinensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size7 574 610 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Taxus chinensis7.57 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type427 records

Wild obs. + sensor6

Museum / vouchered419

Cultivated / captive2

Origin

Native1

Range

Area of Occupancy AOO604 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 5

5 georeferenced · 1 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 1≤1 km 6≤10 km 1>10 km 2

10 georeferenced · 409 without coordinates

Open the institutions mapphysical evidence419

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuhan, CN	153
Chengdu, CN	76
Guilin, CN	48
Edinburgh, GB	44
Paris, FR	24
Saint Louis, US	19
Kew, GB	9
Philadelphia, US	8
Beijing, CN	7
Bronx, US	4
Kunming, CN	3
Nanjing, CN	3
Stockholm, SE	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Bangkok, TH	2
Logan, US	1
Mississippi State, US	1
Moscow State Universitylocation not on record	1
Philadelphia, US	1
Tampa, US	1
LDlocation not on record	1
Taipei, TW	1
Uppsala, SE	1
Taipei, TW	1
South Kensington, GB	1
Servico de Microbiologia e Imunologialocation not on record	1
University of Stellenboschlocation not on record	1
Wlocation not on record	1
Honolulu, US	1

29 institutions · 418 of 419 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA82 detections

Where the DNA of Taxus chinensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found82

Studies independent surveys2

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 82 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 16.8–25.2

Seasonal swing summer↔winter20.0 °C

Max temp (day)21.1 °C 21.1–29.6

Min temp (night)11.9 °C 11.9–21.3

Precipitation57.9 mm/mo 57.9–164

Air humidity58.2 % 58.2–63.4

Moisture balance-61.8 mm/mo -61.8–21.8

Vapour deficit804 Pa 804–1,175

Wind speed2.80 m/s 2.80–3.20

Cloud cover32.8 % 32.8–64.0

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)