Taxillus kaempferi

(DC.) Danser · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Santalales/Loranthaceae/Taxillus

At a glance

Occurrence records132

Data sources8

Biological traits9

DNA specimens0

eDNA detections3

Sources8 archives

Databases and archives Taxillus kaempferi's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility132 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Chemical compositionLOTUS8 compounds

Occurrence & distributionGBIF132 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingNCBIsequences

01Narrative

Taxillus kaempferi () is a parasitic plant species in the genus Taxillus found in China (Anhui, Fujian, W Hubei, S Jiangxi, Sichuan, S Zhejiang), Bhutan and Japan. Its host is Pinus thunbergii.The constituents of Taxillus kaempferi and the host, Pinus thunbergii. I. Catechins and flavones of Taxillus kaempferi. Konishi T, Nishio T, Kiyosawa S, Fujiwara Y and Konoshima T, Yakugaku Zasshi., February 1996, volume 116, issue 2, pages 148-157 (article in Japanese) The flavonol avicularin can be produced from T. kaempferi.Avicularin, a plant flavonoid, suppresses lipid accumulation through repression of C/EBPα-activated GLUT4-mediated glucose uptake in 3T3-L1 cells. Fujimori K and Shibano M, J Agric Food Chem., 29 May 2013, volume 61, issue 21, pages 5139-5147, , Other flavonoids constituents of the plant are hyperin, quercitrin and taxillusin.Chemical studies on the mistletoe. V. The structure of taxillusin, a new flavonoid glycoside isolated from Taxillus kaempferi. Atsushi Sakurai and Yasuaki Okumura, Bulletin of the Chemical Society of Japan, 1983, volume 56, issue 2, pages 542-544,

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formhemiparasitic epiphyte

Life spanperennial

Diet & foraging1

Parasiteobligatory

Habitat & environment6

Climberself-supporting

Elevation max2 600 m

Elevation min2 100 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition8 compounds

Compounds documented for Taxillus kaempferi across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Flavonols3

Dihydroflavonols3

Flavan-3-ols1

Proanthocyanins1

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,3S)-2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,3-dihydrochromen-4-one	present	LOTUS
[6-[[2-(3,4-Dihydroxyphenyl)-5,7-dihydroxy-4-oxo-2,3-dihydrochromen-3-yl]oxy]-3,4,5-trihydroxyoxan-2-yl]methyl 3,4,5-trihydroxybenzoate	present	LOTUS
Avicularin	present	LOTUS
Catechin	present	LOTUS
Hyperin	present	LOTUS
Procyanidin B3	present	LOTUS
Quercitrin	present	LOTUS
Taxillusin	present	LOTUS

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Taxillus kaempferi has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences4

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLLC694063.1 ↗573 bpJapan · 2011

ACGT

AAGAGTACAAATTGACTTATTATACTCCTGATTATGAAACTAAAGATACGGATATTTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAG …

Taxillus kaempferi var. kaempferi TF<JPN>:gfsk0151 chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL4

plant barcode

08Occurrence & distribution

Record type132 records

Wild obs. + sensor7

Museum / vouchered125

Range

Area of Occupancy AOO316 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 5 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤1 km 2≤10 km 8

10 georeferenced · 115 without coordinates

Open the institutions mapphysical evidence125

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tsukuba, JP	25
Sanda, JP	25
FFPRIlocation not on record	16
Odawara, JP	8
Kochi, JP	8
Beijing, CN	6
KURAlocation not on record	5
Kew, GB	4
Nanjing, CN	4
Guangzhou, CN	4
Hangzhou, CN	3
Tomioka, JP	3
Chongqing Museumlocation not on record	2
nlocation not on record	2
Shanghai, CN	1
Chiba, JP	1
Kunming, CN	1
University of Stellenboschlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Zhejiang Museum of Natural Historylocation not on record	1
Beijing, CN	1
Edinburgh, GB	1
Siouxland Heritage Museumlocation not on record	1

23 institutions · 124 of 125 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Taxillus kaempferi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.2 °C 10.4–20.2

Seasonal swing summer↔winter23.4 °C

Max temp (day)23.2 °C 14.5–23.2

Min temp (night)15.7 °C 4.50–15.7

Precipitation286 mm/mo 185–286

Air humidity64.1 % 57.8–64.1

Moisture balance164 mm/mo 99.0–164

Vapour deficit848 Pa 544–848

Wind speed1.90 m/s 1.90–2.40

Cloud cover46.8 % 39.6–46.8

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)