Taxandria spathulata

(Schauer) J.R.Wheeler & N.G.Marchant · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Taxandria

At a glance

Occurrence records470

Data sources7

Biological traits17

DNA specimens0

eDNA detections1

Sources7 archives

Databases and archives Taxandria spathulata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility470 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources17 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF470 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

01Narrative

Taxandria spathulata is a shrub species that grows along the southern coast of Western Australia. This plant was previously classified as Agonis spathulata but is now part of the Taxandria genus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology3

Plant height2 m

Plant height max2 m

Seed mass0.214 mg

Life cycle & reproduction6

Flowering timennnnnnnnyynn

Life formshrub

Life spanperennial

Lifespan years6 years

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Taxandria spathulata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavanones1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
(-)-Pinostrobin		present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Taxandria spathulata has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

matKAF184715.2 ↗2 537 bp

ACGT

GGCTTTTAAGTGCGGCTAGCATTTTTTACACATTTATATGAAGTAACGGATTCGTTCATACCTTCGGTAGAGTTTGTAAGACCACGACTG …

Taxandria spathulata maturase K (matK) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

08Occurrence & distribution

Record type470 records

Wild obs. + sensor172

Museum / vouchered294

Cultivated / captive4

Origin

Native15

Range

Area of Occupancy AOO1 156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 106≤1 km 24≤10 km 4>10 km 7

141 georeferenced · 31 without coordinates

Open the mapobservation + sensor172

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 29≤1 km 37≤10 km 143>10 km 17

226 georeferenced · 68 without coordinates

Open the institutions mapphysical evidence294

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced · 1 without coordinates

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	160
Canberra, AU	40
Museo Entomologico de Leonlocation not on record	35
Adelaide, AU	20
Mount Annan, AU	16
Brisbane, AU	10
BGPAlocation not on record	5
Hobart, AU	3
Kew, GB	3
Armidale, AU	1
Smithfield, AU	1

11 institutions · 294 of 294 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Taxandria spathulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)