Taxandria parviceps

(Schauer) J.R.Wheeler & N.G.Marchant · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Taxandria

At a glance

Occurrence records888

Data sources7

Biological traits24

DNA specimens4

eDNA detections4

Sources7 archives

Databases and archives Taxandria parviceps's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility888 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources24 traits

Occurrence & distributionGBIF888 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Taxandria parviceps foliage and flowers Taxandria parviceps, commonly known as tea tree, is a shrub species that grows on the south west coast of Western Australia. This plant was previously classified as Agonis parviceps but is now part of the Taxandria genus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology6

Fruit width2.1 mm

Leaf length4.75 mm

Leaf width1.05 mm

Plant height3 m

Plant height max4.5 m

Seed mass0.196 mg

Life cycle & reproduction5

Flowering timennnnnnyyyynn

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityfire_killed

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit typecapsule

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: shrub tree

Leaf compoundnesssimple

Leaf shapenarrowly_elliptical narrowly_obovate

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Taxandria parviceps has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences7

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU850647.1 ↗673 bpNew Zealand

ACGT

ATCATTGTCGAATCCTATGGGAAAAAAACGACCAGAGAACCGGTTAAAAACTCGACGAGGACGACGGGTTTTTGCCCGACGTCCCTCGAT …

Taxandria parviceps voucher AK289150 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type888 records

Wild obs. + sensor407

Museum / vouchered479

Cultivated / captive2

Origin

Native42

Introduced2

Range

Area of Occupancy AOO1 904 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 240≤1 km 67≤10 km 22>10 km 11

340 georeferenced · 67 without coordinates

Open the mapobservation + sensor407

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 90≤1 km 31≤10 km 207>10 km 39

367 georeferenced · 112 without coordinates

Open the institutions mapphysical evidence479

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	275
Museo Entomologico de Leonlocation not on record	57
Canberra, AU	47
Mount Annan, AU	42
Adelaide, AU	24
Brisbane, AU	15
BGPAlocation not on record	10
Auckland, NZ	3
Rotorua, NZ	3
Hobart, AU	1
Armidale, AU	1
Smithfield, AU	1

12 institutions · 479 of 479 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Taxandria parviceps was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)