Taxandria marginata

(Labill.) J.R.Wheeler & N.G.Marchant · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Taxandria

At a glance

Occurrence records339

Data sources7

Biological traits23

DNA specimens4

eDNA detections4

Sources7 archives

Databases and archives Taxandria marginata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility339 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources23 traits

Occurrence & distributionGBIF339 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Taxandria marginata is a species of shrub that grows in the south west corner of Western Australia. This plant was previously classified as Agonis marginata but was reclassified by Wheeler and Marchant into the new genus Taxandria in a 2007 revision. The shrub typically grows to a height of 2 to. It produces white flowers between February and August. It grows around granite boulders and among rocky outcrops in coastal areas in skeletal sandy, loamy or clay soils. The species is found along the south coast of Western Australia in the Great Southern and Goldfields-Esperance regions.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology7

Fruit width3 mm

Leaf length18.5 mm

Leaf width6.5 mm

Petiole length0.3 cm

Plant height2 m

Plant height max3 m

Seed mass0.409 mg

Life cycle & reproduction5

Flowering timenyyyyyyynnnn

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical obovate

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Taxandria marginata has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences5

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKM064789.1 ↗641 bp

ACGT

CTTATGGAAAAAAACGACCAGAGAACCGGTTAAAAACTCGACGAGGACGGCGGGTTTTCGCCCGACGTCCCTCGATACGCTTGGGACCGC …

Taxandria marginata M78 NZFRI 29085 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type339 records

Wild obs. + sensor164

Museum / vouchered173

Cultivated / captive2

Origin

Native18

Range

Area of Occupancy AOO508 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 87≤1 km 21≤10 km 12>10 km 10

130 georeferenced · 34 without coordinates

Open the mapobservation + sensor164

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 14≤1 km 19≤10 km 90>10 km 8

131 georeferenced · 42 without coordinates

Open the institutions mapphysical evidence173

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	83
Museo Entomologico de Leonlocation not on record	25
Mount Annan, AU	19
Canberra, AU	16
BGPAlocation not on record	8
Rotorua, NZ	6
Brisbane, AU	5
Auckland, NZ	4
Adelaide, AU	4
Kew, GB	1
Christchurch, NZ	1
Palmerston, AU	1

12 institutions · 173 of 173 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Taxandria marginata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)