Taxandria juniperina

(Schauer) J.R.Wheeler & N.G.Marchant · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Taxandria

At a glance

Occurrence records254

Data sources9

Biological traits25

DNA specimens5

eDNA detections5

Sources9 archives

Databases and archives Taxandria juniperina's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility254 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources25 traits

Occurrence & distributionGBIF254 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Taxandria juniperina flowers Taxandria juniperina commonly known as wattie, native cedar, Warren River cedar or juniper myrtle is a species of tree that grows in the south west corner of Western Australia. This plant was previously classified as Agonis juniperina but is now part of the genus Taxandria. The Noongar peoples know the tree as watti.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology6

Leaf length13.5 mm

Leaf length max9 mm

Leaf width1.15 mm

Plant height27 m

Plant height max27 m

Seed mass0.257 mg

Life cycle & reproduction7

Deciduousnessevergreen

Flowering timenyyyynnnnnnn

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Reproductive maturity4 years

Resprouting capacityfire_killed

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree

Habitat GIFTLowland

Leaf compoundnesssimple

Leaf shapelinear

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Taxandria juniperina has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes2

GenBank sequences8

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU850649.1 ↗558 bpNew Zealand

ACGT

CCGGTTAAAAACTCGACGAGGACGGTGGGTTTCCGCCCGACGTCCCTCGATACGCCTTGGGATCGCGTAGGTGCCTTGTGCGCTTAAGCT …

Taxandria juniperina voucher AK281553 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type254 records

Wild obs. + sensor79

Museum / vouchered172

Cultivated / captive3

Origin

Native8

Introduced3

Range

Area of Occupancy AOO668 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 42≤1 km 12≤10 km 6>10 km 7

67 georeferenced · 12 without coordinates

Open the mapobservation + sensor79

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 27≤1 km 22≤10 km 67>10 km 9

125 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence172

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 1 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	80
Canberra, AU	17
Museo Entomologico de Leonlocation not on record	14
Mount Annan, AU	11
Auckland, NZ	10
Rotorua, NZ	10
Adelaide, AU	10
Brisbane, AU	7
Christchurch, NZ	3
BGPAlocation not on record	3
Kew, GB	2
Palmerston, AU	2
Hobart, AU	1
Armidale, AU	1
QVMAGlocation not on record	1

15 institutions · 172 of 172 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Taxandria juniperina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)