Tarlmounia elliptica

(DC.) H.Rob., S.C.Keeley, Skvarla & R.Chan · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Tarlmounia

At a glance

Occurrence records280

Data sources11

Biological traits13

DNA specimens7

eDNA detections5

Sources11 archives

Databases and archives Tarlmounia elliptica's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility280 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources13 traits

Chemical compositionLOTUS6 compounds

Occurrence & distributionGBIF280 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Tarlmounia is a plant genus in the family Asteraceae. The sole species is Tarlmounia elliptica (syn. Vernonia elliptica and V. elaeagnifolia), native to India, Burma and Thailand and naturalised in southern Taiwan and Queensland, Australia. Common names include curtain creeper, vernonia creeper and parda bel.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology4

Fruit length2.05 mm

Leaf length40 mm

Leaf width25 mm

Petiole length2.5 cm

Life cycle & reproduction2

Life formshrub

Life spanperennial

Habitat & environment7

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit typeachene

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: climber · TRY: Climber

Leaf shapeelliptical oblong

Woodinesswoody

03Chemical composition6 compounds

Compounds documented for Tarlmounia elliptica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Germacrane sesquiterpenoids2

Lupane triterpenoids2

Ursane and Taraxastane triterpenoids1

Cholestane steroids $ Stigmastane steroids1

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
2-Propenoic acid, 2-methyl-, (1aR,5R,7S,10aS,10bR)-5-(acetyloxy)-8-((acetyloxy)methyl)-1a,2,3,4,5,6,7,9,10a,10b-decahydro-1a,5-dimethyl-4,9-dioxooxireno(9,10)cyclodeca(1,2-b)furan-7-yl ester	present	LOTUS
[(4aR,6aS,6aR,6bR,8aR,12aS,14aS,14bR)-4,4,6a,6b,8a,12,14b-heptamethyl-11-methylidene-1,2,3,4a,5,6,6a,7,8,9,10,12,12a,13,14,14a-hexadecahydropicen-3-yl] acetate	present	LOTUS
Glaucolide B	present	LOTUS
Lupeol	present	LOTUS
Lupeol Acetate	present	LOTUS
Stigmasterol	present	LOTUS

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tarlmounia elliptica has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences9

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSEF155813.1 ↗640 bp

ACGT

TCAAACGTCATACTTCAAAATGACCTGTGAACACGTACTGACAATCTAGGGTTGAAGAAACAGGTTCATGCCTGTGACTTTTATGCCCTG …

Vernonia elliptica isolate Velliptica483 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Tarlmounia elliptica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidydiploid inferred

Chromosome records38–402n range40median40mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 405×CCDB · ipcn-api-dl · CCDB · book-indian_vol1

CCDB · ipcn-api-dl — Mathew, A. & P. M. Mathew. 1982a. Studies on the south Indian Compositae IV. Karyomorphology of eight species of Vernonia Schreb. Cytologia 47: 163–169.

CCDB · ipcn-api-dl — Mathew, P. M. & A. Mathew. 1983. Studies on the south Indian Compositae V. Cytotaxonomic consideration of the tribes Vernonieae and Eupatorieae. Cytologia 48: 679–690.

CCDB · ipcn-api-dl — Mathew, A. & P. M. Mathew. 1988. Cytological studies on the south Indian Compositae. Glimpses Pl. Res. 8: 1–177.

CCDB · ipcn-api-dl — Mathew, A. & P. M. Mathew. 1976. Studies on south Indian Compositae. II. Cytology of the genus Vernonia Schreb. Cytologia 41: 401–406.

CCDB · book-indian_vol1 — Shukur, A. 1967; Sharma, A. & Sarkar, A.K. 1967-1968 ; Dey, D. & Sharma, A.K. 1969; Mathew, A. & Mathew, P.M. 1976

2n 381×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Sharma, A.K. & Varma, B. 1960

n 205×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71

CCDB · ipcn-api-dl — Sarkar, A. K., N. DATTA, U. Chatterjee & D. Hazra. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 576–579.

CCDB · ipcn-api-dl — Mathew, A. & P. M. Mathew. 1988. Cytological studies on the south Indian Compositae. Glimpses Pl. Res. 8: 1–177.

CCDB · ipcn-api-dl — Mathew, A. & P. M. Mathew. 1976. Studies on south Indian Compositae. II. Cytology of the genus Vernonia Schreb. Cytologia 41: 401–406.

CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.

CCDB · book-ipcn67-71 — SHARMA, A., & A.K. SARKAR (Editors). 1967-68. Chromosome number reports of plants in Annual Report, Cytogenetics Laboratory, Department of"li"otany, University of Calcutta. The Research Bulletin. 2: 38-Q8.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type280 records

Wild obs. + sensor226

Museum / vouchered54

Origin

Introduced7

Range

Area of Occupancy AOO320 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 112≤1 km 21≤10 km 2>10 km 2

137 georeferenced · 89 without coordinates

Open the mapobservation + sensor226

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 29≤1 km 11≤10 km 7

47 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence54

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	12
Canberra, AU	8
Palmerston, AU	8
Smithfield, AU	7
Museo Entomologico de Leonlocation not on record	3
Cibinong Science Center, Herbarium Bogorienselocation not on record	3
Mount Annan, AU	2
Baroda, IN	2
Kensington, AU	2
Philadelphia, US	1
James Cook Townsvillelocation not on record	1
University of Stellenboschlocation not on record	1
Adelaide, AU	1
Pondicherry, IN	1

14 institutions · 52 of 54 vouchered records shown · 2 without an institution code

09Environmental DNA5 detections

Where the DNA of Tarlmounia elliptica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 26.1–26.1

Seasonal swing summer↔winter1.10 °C

Max temp (day)29.5 °C

Min temp (night)22.6 °C

Precipitation269 mm/mo

Air humidity68.1 %

Moisture balance133 mm/mo

Vapour deficit1,080 Pa

Wind speed1.20 m/s

Cloud cover57.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)