Tarenna sechellensis — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Tarenna

At a glance

Occurrence records270

Data sources6

Biological traits11

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Tarenna sechellensis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility270 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF270 records

DNA & barcodingNCBIsequences

01Narrative

Tarenna sechellensis is a species of plant in the family Rubiaceae. It is known from the Seychelles, Madagascar and Mayotte. The English botanist John Gilbert Baker was the first to formally describe this species in 1877 (in the genus Webera), subsequently V. S. Summerhayes assigned the species to the genus Tarenna.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tarenna sechellensis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

matKKJ815992.1 ↗2 456 bp

ACGT

GTGCGGCTAGCATCTTTTACACATTTAGATGAAGCAGGGGATTCATCTATACCATCGGTAAAGTTTGGAAGACCACGACTGATCCTGAAA …

Tarenna sechellensis voucher Bremer et al. 5412 (S) maturase K (matK) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1

plant barcode

08Occurrence & distribution

Record type270 records

Wild obs. + sensor224

Museum / vouchered46

Origin

Native63

Range

Area of Occupancy AOO180 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 104

104 georeferenced · 120 without coordinates

Open the mapobservation + sensor224

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence46

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Seychelles National Herbariumlocation not on record	5
Paris, FR	1

2 institutions · 6 of 46 vouchered records shown · 40 without an institution code