Tarenna nilagirica

(Bedd.) Bremek. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Tarenna

At a glance

Occurrence records26

Data sources8

Biological traits6

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Tarenna nilagirica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility26 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Occurrence & distributionGBIF26 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 22

01Narrative

Tarenna nilagirica is a species of plant in the family Rubiaceae. It is native to Karnataka and Kerala in India.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formshrub

Life spanperennial

Habitat & environment3

Climatewet tropical

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tarenna nilagirica has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences6

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLOQ700003.1 ↗363 bpIndia · 2022

ACGT

AAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCGGGAG …

Tarenna nilagirica isolate TS3 ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Tarenna nilagirica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 114×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Bir, S. S. & G. S. Chatha. 1987. Meiotic analysis of woody elements of south Indian Rubiaceae. Nucleus (Calcutta) 30: 114–124.

CCDB · ipcn-api-dl — Chatha, G. S. & S. S. Bir. 1987. Cytological evaluation of woody taxa of Gamopetalae and Monochlamydeae from south India. Aspects Pl. Sci. 9: 199–244.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.988 ↗

08Occurrence & distribution

Record type26 records

Wild obs. + sensor17

Museum / vouchered9

Range

Area of Occupancy AOO40 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 16

16 georeferenced · 1 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 9 records without

Open the institutions mapphysical evidence9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	3

1 institutions · 3 of 9 vouchered records shown · 6 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)