Tarenna asiatica

(L.) Kuntze ex K.Schum. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Tarenna

At a glance

Occurrence records213

Data sources9

Biological traits12

DNA specimens5

eDNA detections7

Sources9 archives

Databases and archives Tarenna asiatica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility213 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF213 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 22

01Narrative

锡兰玉心花（学名：），为茜草科乌口树属下的一个植物种。种名zeylanica意为斯里兰卡的。

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height6 m

Life cycle & reproduction3

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · TRY: shrub

Woodinesswoody

Physiology & chemistry2

Leaf dry-matter content (LDMC)238 mg/g

Specific leaf area (SLA)5.37 mm²/mg

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tarenna asiatica has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences10

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPP711728.1 ↗642 bp

ACGT

GAACCTGCGGAAGGATCATTGTCGAATCCTGCGAAGCAGACGACCGCGAACTCGTGCTACCGCCGGGCGTCGGGGGCAGGGTCGCCGGGG …

Tarenna asiatica voucher Lundqvist 8952 (UPS) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL3★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Tarenna asiatica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Raghavan T. S., Rangaswamy 1941

CCDB · book-atlas-flowering-plants — Raghavan & R. 1941 -

n 112×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Singh, G., S. S. Bir & B. S. Gill. 1982. In: IOPB chromosome number reports LXXVII. Taxon 31: 776.

CCDB · ipcn-api-dl — Bir, S. S. & G. S. Chatha. 1987. Meiotic analysis of woody elements of south Indian Rubiaceae. Nucleus (Calcutta) 30: 114–124.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.988 ↗

08Occurrence & distribution

Record type213 records

Wild obs. + sensor142

Museum / vouchered70

Cultivated / captive1

Range

Area of Occupancy AOO568 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 40≤1 km 26≤10 km 17>10 km 7

90 georeferenced · 52 without coordinates

Open the mapobservation + sensor142

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 2

3 georeferenced · 67 without coordinates

Open the institutions mapphysical evidence70

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	52
Kew, GB	2
Stockholm, SE	1
Claremont, US	1
Dresden, DE	1
Dehra Dun, IN	1
Forestry and Forest Products Research Institutelocation not on record	1

7 institutions · 59 of 70 vouchered records shown · 11 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Tarenna asiatica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.5 °C 16.2–24.3

Seasonal swing summer↔winter11.5 °C

Max temp (day)22.0 °C 17.1–25.0

Min temp (night)16.8 °C 14.8–23.5

Precipitation198 mm/mo 173–321

Air humidity58.3 % 57.6–63.3

Moisture balance71.2 mm/mo 11.0–207

Vapour deficit872 Pa 774–1,196

Wind speed4.90 m/s 2.40–5.50

Cloud cover32.3 % 29.2–48.3

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)