Taraxacum platycarpum

Dahlst. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Taraxacum

At a glance

Occurrence records1 535

Data sources11

Biological traits4

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Taraxacum platycarpum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 535 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources4 traits

Chemical compositionLOTUS · NPASS190 compounds

Occurrence & distributionGBIF1 535 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Taraxacum platycarpum, also called the Korean dandelion, is a species of dandelion that grows in Korea. A member of the Cichorieae tribe of the Asteraceae, it also grows in other countries as a native plant, such as China and Japan.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction1

Life formperennial

Habitat & environment3

Climatetemperate

Growth formherb

Woodinessnon-woody

03Chemical composition190 compounds

Compounds documented for Taraxacum platycarpum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cinnamic acids and derivatives29

Guaiane sesquiterpenoids13

Unsaturated fatty acids12

Flavones10

Flavonols9

Documented compounds190 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Chicoricacid	present	NPASS
(+)-Valine	present	NPASS
(-)-Carnitine	present	NPASS
(-)-Chicoric acid	present	LOTUS
(2E,7R,11R)-2-Phyten-1-ol	present	NPASS
(3aS,6E,10Z,11aR)-6-methyl-3-methylidene-10-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-2-one	present	LOTUS
(3R,3aR,4S,9aS,9bR)-3-hydroxy-3,6,9-trimethyl-4-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4,5,9a,9b-tetrahydro-3aH-azuleno[4,5-b]furan-2,7-dione	present	LOTUS
(3R,3aR,9aS,9bR)-3,6,9-trimethyl-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4,5,9a,9b-tetrahydro-3aH-azuleno[4,5-b]furan-2,7-dione	present	LOTUS
(3S,3aR,4S,6E,9R,10E,11aR)-4-hydroxy-3,6,10-trimethyl-9-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3a,4,5,8,9,11a-hexahydro-3H-cyclodeca[b]furan-2-one	present	LOTUS
(3S,3aR,4S,9aS,9bR)-3,4-dihydroxy-3-(hydroxymethyl)-6,9-dimethyl-4,5,9a,9b-tetrahydro-3aH-azuleno[4,5-b]furan-2,7-dione	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Taraxacum platycarpum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences10

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKP214504.1 ↗422 bpSouth Korea

ACGT

TCGAACCCTGCAAGGCAGAACGACCCGTGAACACGTAAATACAACCGGGTGATGGGGAGATGGATCTTGGTTTTGATTCTCAGCACCTTC …

Taraxacum platycarpum voucher YNUH DD042S internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL6★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Taraxacum platycarpum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidypolyploid inferred

Chromosome records16–322n range20median16mode12records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 166×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Yamaguchi, S. 1976. Chromosome numbers of Japanese Taraxacum species. J. Jap. Bot. 51: 52–58.

2n 245×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74

CCDB · ipcn-api-dl — Yamaguchi, S. 1976. Chromosome numbers of Japanese Taraxacum species. J. Jap. Bot. 51: 52–58.

CCDB · ipcn-api-dl — Sun, B. y., M. R. Sul, J. A. Im, C. H. Kim & T. J. Kim. 2002. Evolution of endemic vascular plants of Ulleungdo and Dokdo in Korea---floristic and cytotaxonomic characteristics of vascular flora of Dokdo. Korean J. Pl. Taxon. 32: 143–158.

CCDB · book-ipcn67-71 — TAKEMOTO, T. 1970. Chromosome studies on three tetraploid races of Taraxacum. Kromosomo 79-80: 2539-2547.

CCDB · book-ipcn67-71 — LEE, Y.N. 1970. Chromosome number of flowering plants in Korea (3) J. Korean Res. Inst. Better Living 5: 127-129.

CCDB · book-ipcn73-74 — LEE, Y.N., & Y.C. OH. 1970. Taxonomic study on genus Taraxacum in South Korea. J. Korean Res. Inst. Better Living 4: 63 68.

2n 321×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Nishikawa, T. 1984. Chromosome counts of flowering plants of Hokkaido (7). J. Hokkaido Univ. Educ., Sect. 2B 35: 31–42.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 535 records

Wild obs. + sensor922

Museum / vouchered613

Range

Area of Occupancy AOO3 376 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 324≤1 km 22≤10 km 1>10 km 5

352 georeferenced · 570 without coordinates

Open the mapobservation + sensor922

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤1 km 7≤10 km 33

40 georeferenced · 573 without coordinates

Open the institutions mapphysical evidence613

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Odawara, JP	182
Chiba, JP	113
Bando, JP	51
KR	38
Nagano City, JP	36
Nagatoro-machi, Chichibu-gun, JP	15
Fukushima Universitylocation not on record	15
NSMKlocation not on record	11
Sanda, JP	5
Inner Mongolia Universitylocation not on record	5
Kochi, JP	2
Moscow State Universitylocation not on record	2
Taipei, TW	2
Omachi Alpine Museumlocation not on record	1
Oiso Municipal Museumlocation not on record	1
SIHUlocation not on record	1
Tokushima, JP	1
Taipei, TW	1
Sendai, JP	1
Ciudad Autónoma de Buenos Aires, AR	1
Chengdu, CN	1
DNSMlocation not on record	1
Sagamihara, JP	1
KNAMlocation not on record	1
Beijing, CN	1
Korea National Arboretumlocation not on record	1
Toyama, JP	1

27 institutions · 491 of 613 vouchered records shown · 122 without an institution code

09Environmental DNA1 detections

Where the DNA of Taraxacum platycarpum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Taraxacum platycarpum

At a glance

Sources11 archives

Life cycle & reproduction1

Habitat & environment3

Compound class profile5 classes

Documented compounds190 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 535 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 535 records