Taraxacum officinale
Weber ex F.H.Wigg. · speciesAt a glance
Occurrence records423 161
Data sources14
Biological traits82
DNA specimens88
eDNA detections57
Sources14 archives
Databases and archives Taraxacum officinale's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility423 161 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI57 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics88 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources82 traits
Chemical compositionFooDB · LOTUS · NPASS5 886 compounds
Occurrence & distributionGBIF423 161 records
Environmental DNA2 datasets · 12 countries57 detections
DNA & barcodingBOLD · NCBI88 specimens
Genome at a glanceCCDB · GoaT1.2 Gbp
01Narrative
Taraxacum officinale est un nom scientifique qui a décrit une espèce puis un agrégat d'espèces du genre Taraxacum. C'est-à-dire, en termes vernaculaires, que ce nom a été donné à un pissenlit puis à un ensemble de plusieurs espèces de pissenlits. Le nom Taraxacum officinale n'est plus valide même s'il reste très employé. On l'utilise par facilité, même s'il est source de confusion dans une classification du genre Taraxacum déjà très complexe. « C'est le pissenlit qui donne, vers le commencement de mai, la première miellée notable du printemps, fournissant abondamment aux abeilles, que l'on peut cesser de nourrir à ce moment, nectar et pollen. » — Frère Marie-Victorin, Flore laurentienne, 1935.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesLEDAUSDATRY
Size & morphology2
Plant height0.152 m
Seed mass0.532 mg
Life cycle & reproduction22
After harvest regrowth rateModerate
Bloom periodEarly Spring
Coppice potentialNo
Flower colouryellow
Flower conspicuousYes
Fruit seed period beginSpring
Fruit seed period endSummer
Growth rate USDARapid
Lifespan categoryShort
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Resprout abilityNo
Seed spread rateRapid
Seedling vigorHigh
Vegetative spread rateNone
Habitat & environment20
Active growth periodSpring and Fall
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
BloatNone
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colourbrown
Growth formherb
Growth form USDASingle Crown
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Root depth min6 in
Shape and orientationProstrate
Small grainNo
Woodinessnon-woody
Physiology & chemistry19
Anaerobic toleranceNone
C:N ratioLow
Caco3 toleranceLow
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementLow
Fire resistantNo
Frost free days min100 days
Moisture useMedium
Nitrogen fixation levelNone
Precipitation max55 in
Precipitation min12 in
Salinity toleranceNone
Seed longevity index0
Shade toleranceMedium
Soil pH max7.5 pH
Soil pH min4.8 pH
Specific leaf area (SLA)29.07 mm²/mg
Temperature min-38 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable graze animalLow
Palatable humanYes
Post productNo
Pulpwood productNo
Seeds per pound562 480 per lb
ToxicityNone
Veneer productNo
Other traits4
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
03Chemical composition5 886 compounds
Compounds documented for Taraxacum officinale across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingHerbs and Spices
Compound class profile5 classes
Aminoacids85
Unsaturated fatty acids74
Cinnamic acids and derivatives67
Glycerophospholipids57
Monosaccharides34
Documented compounds5 886 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Inulin | 32,500 mg/100g | FooDB | |
| Retinol | 14,544 IU | FooDB | |
| Pectic acid | 7,800 mg/100g | FooDB | |
| Potassium | 4,350 mg/100g | FooDB | |
| Phosphatidylcholine | 2,970 mg/100g | FooDB | |
| Calcium | 1,650 mg/100g | FooDB | |
| Sugars | 1,620 mg/100g | FooDB |
05DNA & barcoding88 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Taraxacum officinale has left across the world's sequence archives.
At a glance
DNA specimens88
Marker genes9
GenBank sequences9
eDNA detections57
Countries12
The DNA barcodea real sequence read deposited for this species
ACGATACATTGGGTTCTTTTTTGAGGGTTTCCCNTAGCAGCTCACAACACACAGCAGAAGAAAAGGGTCTTTACAACCACCACTAGCCGT …
Taraxacum officinale voucher UKIC_0044262 internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK1★rbcL4★rbcLa★trnL-F★ITS4★ITS1★ITS2trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Taraxacum officinale carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 247 448 979 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Taraxacum officinale1.25 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidy2× diploid · measured
Chromosome records16–242n range19median16mode4records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type423 161 records
Wild obs. + sensor394 502
Museum / vouchered28 246
Cultivated / captive393
Fossil1
Other19
Origin
Native102
Introduced359
Range
Area of Occupancy AOO433 192 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy43% within 1 km
≤100 m 108 407≤1 km 39 713≤10 km 188 193>10 km 4 776
341 089 georeferenced · 53 413 without coordinates
Open the mapobservation + sensor394 502
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy42% within 1 km
≤100 m 2 266≤1 km 7 148≤10 km 12 322>10 km 538
22 274 georeferenced · 5 972 without coordinates
Open the institutions mapphysical evidence28 246
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy2% within 1 km
≤100 m 1≤1 km 1≤10 km 89
91 georeferenced · 302 without coordinates
Open the mapnot free-living393
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions264 of 486 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 15 414 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 1 150 |
| Moscow State Universitylocation not on record | 388 |
| KMNlocation not on record | 314 |
| Madison, US | 276 |
| Wuzhou, CN | 261 |
| Chongqing Museumlocation not on record | 254 |
| Philadelphia, US | 230 |
| Görlitz, DE | 224 |
| Chapel Hill, US | 212 |
| Uniwersytet Warszawskilocation not on record | 208 |
| Durango, MX | 175 |
| Green Bay, US | 171 |
| Saint Louis, US | 165 |
| Nagano City, JP | 153 |
| St. Paul, US | 153 |
| Uppsala, SE | 148 |
| Bronx, US | 131 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 120 |
| Québec, CA | 111 |
| Denver, US | 109 |
| Claremont, US | 108 |
| Moscow, US | 107 |
| Université Lavallocation not on record | 102 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 102 |
| DOI/NPS, Greenbelt Parklocation not on record | 94 |
| Pullman, US | 91 |
| Flagstaff, US | 90 |
| Albuquerque, US | 89 |
| Chadron, US | 87 |
| Austin, US | 85 |
| Vancouver, CA | 85 |
| Riverside, US | 82 |
| Bloomington, US | 81 |
| Kochi, JP | 81 |
| ASUlocation not on record | 79 |
| University of New Hampshirelocation not on record | 78 |
| Shinshu Universitylocation not on record | 78 |
| Mexico City, MX | 78 |
| Mexico City, MX | 75 |
| DMZ botanic gardenlocation not on record | 74 |
| Ann Arbor, US | 74 |
| Fukushima Universitylocation not on record | 70 |
| Christchurch, NZ | 68 |
| Corvallis, US | 64 |
| College Park, US | 64 |
| Millersville, US | 61 |
| Karlsruhe, DE | 60 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 58 |
| Fort Worth, US | 58 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 58 |
| Provo, US | 53 |
| Toyama, JP | 52 |
| Montréal, CA | 52 |
| Guasave, MX | 52 |
| University of Stellenboschlocation not on record | 51 |
| Mlocation not on record | 50 |
| Burlington, US | 47 |
| Williamsburg, US | 45 |
| Toronto, CA | 45 |
| Arcata, US | 44 |
| Saint John, CA | 41 |
| Acadia Universitylocation not on record | 40 |
| University of Alberta Museumslocation not on record | 39 |
| Victoria, CA | 38 |
| UChlocation not on record | 38 |
| Davis, US | 37 |
| EL PASO, US | 37 |
| Pittsburg, US | 36 |
| Pocatello, US | 36 |
| Spearfish, US | 36 |
| Allentown, US | 36 |
| Barcelona, ES | 36 |
| Canadian Department of Agriculturelocation not on record | 35 |
| Boise, US | 35 |
| Missoula, US | 34 |
| Zürich, CH | 34 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 33 |
| Córdoba, AR | 33 |
| Santa Barbara, US | 33 |
| Uniwersytet Opolskilocation not on record | 33 |
| Whitewater, US | 32 |
| Jyväskylä, FI | 32 |
| Urumqi, CN | 32 |
| Angwin, US | 31 |
| Bangkok, TH | 30 |
| Jackson, US | 30 |
| CASlocation not on record | 30 |
| Tampa, US | 30 |
| New Haven, US | 30 |
| Zacatecas, MX | 29 |
| San Luis Obispo, US | 29 |
| McWane Science Centerlocation not on record | 28 |
| San Diego, US | 28 |
| Emporia, US | 27 |
| Ciudad Autónoma de Buenos Aires, AR | 26 |
| Logan, US | 26 |
| Western Carolina Universitylocation not on record | 26 |
| Tsukuba, JP | 26 |
| Bozeman, US | 25 |
| Trondheim, NO | 24 |
| Phoenix, US | 24 |
| PRClocation not on record | 23 |
| Tallinn, EE | 23 |
| Juriquilla, MX | 21 |
| MAlocation not on record | 21 |
| Jena Microbial Resource Collectionlocation not on record | 21 |
| Rocky Mountain Biological Laboratorylocation not on record | 21 |
| Caldwell, US | 21 |
| Lubbock, US | 20 |
| Kew, GB | 20 |
| Jardín Botánico de Bogotá José Celestino Mutis (JBB)location not on record | 19 |
| Wellington, NZ | 19 |
| Durango, US | 19 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 19 |
| San Isidro, AR | 18 |
| Tokushima, JP | 18 |
| Iwate Prefectural Museumlocation not on record | 18 |
| US | 17 |
| Philadelphia, US | 17 |
| Vitoria, ES | 16 |
| Portland, US | 16 |
| Ciudad de México, MX | 16 |
| Wlocation not on record | 16 |
| Lord Fairfax Community Collegelocation not on record | 16 |
| Blumenau, BR | 16 |
| Mississippi State, US | 16 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 15 |
| Adam Mickiewicz University in Poznańlocation not on record | 15 |
| Bando, JP | 15 |
| Staten Island, US | 15 |
| Natural History Museum Rotterdamlocation not on record | 15 |
| Universidad Nacional de Colombia (UNAL)location not on record | 15 |
| Otaru, JP | 15 |
| Sanda, JP | 15 |
| Tempe, US | 15 |
| GAlocation not on record | 15 |
| Cheney, US | 15 |
| National Institute of Biological Resourceslocation not on record | 14 |
| Turlock, US | 14 |
| Knoxville, US | 14 |
| BAYLUlocation not on record | 13 |
| Tula State Universitylocation not on record | 13 |
| Nishihara, JP | 13 |
| Columbia, US | 13 |
| Universidad Industrial de Santander (UIS)location not on record | 13 |
| Anchorage, US | 13 |
| Zapopan, MX | 13 |
| NSMKlocation not on record | 13 |
| GJOlocation not on record | 13 |
| Fayetteville, US | 13 |
| Torreón, MX | 13 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 12 |
| US | 12 |
| Universidad de Antioquia (UdeA)location not on record | 12 |
| Uniwersytet Śląski w Katowicachlocation not on record | 12 |
| MeiseBGlocation not on record | 12 |
| Waverly, US | 12 |
| UTPLlocation not on record | 12 |
| Altos de Pipe, VE | 12 |
| Kushiro City Museumlocation not on record | 11 |
| Irvine, US | 11 |
| USFS/BHSClocation not on record | 11 |
| San Angelo, US | 11 |
| Tuscaloosa, US | 11 |
| Universidad de Caldas (UCaldas)location not on record | 11 |
| Korea National Arboretumlocation not on record | 11 |
| València, ES | 10 |
| Grand Junction, US | 10 |
| Truckee, US | 10 |
| Puebla, MX | 10 |
| Lincoln, US | 10 |
| Paris, FR | 10 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 9 |
| Rotorua, NZ | 9 |
| Los Angeles, US | 9 |
| Kandalaksha State Nature Reservelocation not on record | 9 |
| Austin, US | 9 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 9 |
| Mexico City, MX | 9 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 9 |
| AASlocation not on record | 9 |
| Springfield, US | 8 |
| Sendai, JP | 8 |
| Walla Walla, US | 8 |
| Miami, US | 8 |
| Long Beach, US | 8 |
| GB | 8 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 8 |
| Taipei, TW | 8 |
| Johnson City, US | 8 |
| Olocation not on record | 8 |
| Hudson, US | 8 |
| Keene State Universitylocation not on record | 8 |
| Fredericksburg, US | 8 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 8 |
| Tlalnepantla, MX | 8 |
| Orem, US | 7 |
| Puerto Ayora, EC | 7 |
| Dover, US | 7 |
| QCNElocation not on record | 7 |
| Corrientes, AR | 7 |
| China Agricultural Universitylocation not on record | 7 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 7 |
| Guatemala City, GT | 7 |
| Laboratory of Palaeontologylocation not on record | 7 |
| Texas Lutheran Universitylocation not on record | 7 |
| Honolulu, US | 7 |
| Beijing, CN | 7 |
| Henderson, US | 7 |
| Berlin, DE | 7 |
| Yangling, CN | 7 |
| KNAMlocation not on record | 7 |
| BISHlocation not on record | 6 |
| Antiguo Cuscatlán, SV | 6 |
| Valdosta State Universitylocation not on record | 6 |
| Nanjing, CN | 6 |
| University of Guelph, OAC Herbariumlocation not on record | 6 |
| Universidad de La Salle (La Salle)location not on record | 6 |
| National Biodiversity Institute, Costa Ricalocation not on record | 6 |
| New Brunswick, US | 6 |
| Valparaíso, CL | 6 |
| GZUlocation not on record | 6 |
| Aarhus, DK | 6 |
| Montecillo, Texcoco, MX | 6 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 6 |
| JP | 6 |
| Nishihara, JP | 6 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 6 |
| Ashland, US | 6 |
| KR | 6 |
| Washington, US | 6 |
| AUAlocation not on record | 5 |
| Museum of the Rockieslocation not on record | 5 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 5 |
| Severin-McDaniel Insect Collectionlocation not on record | 5 |
| Istituto Agrario Castelnuovolocation not on record | 5 |
| Criciúma, BR | 5 |
| Maringá, BR | 5 |
| Brookings, US | 5 |
| PUC-RSlocation not on record | 5 |
| Riobamba, EC | 5 |
| Hangzhou, CN | 5 |
| ROM007location not on record | 5 |
| Tartu, EE | 5 |
| CICYTEXlocation not on record | 5 |
| Tilburg, NL | 5 |
| Whitehorse, CA | 5 |
| Chapingo, MX | 5 |
| Dresden, DE | 5 |
| KOMlocation not on record | 5 |
| UNESClocation not on record | 5 |
| San Francisco, US | 5 |
| Kirksville, US | 5 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 5 |
| J.F.Oberlin Universitylocation not on record | 5 |
| USFSlocation not on record | 5 |
| Denton, US | 5 |
| Chicago, US | 5 |
| Durham, US | 4 |
| Museo Achille Folettolocation not on record | 4 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 4 |
| Minia, EG | 4 |
| BClocation not on record | 4 |
| Richmond, US | 4 |
| Servico de Microbiologia e Imunologialocation not on record | 4 |
| Santa Cruz de la Sierra, BO | 4 |
| Santa Cruz, US | 4 |
| WNNUlocation not on record | 4 |
| Royal Botanical Gardenslocation not on record | 4 |
| Bourges, FR | 4 |
| LDlocation not on record | 4 |
| Madrid, ES | 4 |
| IEBlocation not on record | 4 |
| Edmonton, CA | 4 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 4 |
| FUNEDlocation not on record | 4 |
| DASSHlocation not on record | 4 |
| TROMlocation not on record | 4 |
| Weber State Universitylocation not on record | 4 |
| Podgorica, ME | 4 |
| Eastern Nevada Landscape Coalitionlocation not on record | 4 |
| IDElocation not on record | 4 |
| Fairfax, US | 4 |
| Culiacán, MX | 4 |
| University of British Columbia, Herbariumlocation not on record | 4 |
| Clemson, US | 4 |
| Banyoles, ES | 4 |
| Tacoma, US | 4 |
| Bend, US | 4 |
| Chicago, US | 4 |
| Sucre, BO | 4 |
| University of Southern Mississippilocation not on record | 4 |
| DOI/NPS, Craters of the Moon National Monument & Preservelocation not on record | 3 |
| KNFYlocation not on record | 3 |
| UoB-IBlocation not on record | 3 |
| UFPRlocation not on record | 3 |
| IWEP FEB RASlocation not on record | 3 |
| Hazara Universitylocation not on record | 3 |
| Tomioka, JP | 3 |
| KIRMlocation not on record | 3 |
| La Paz, BO | 3 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 3 |
| Tuxtla Gutiérrez, MX | 3 |
| Bandelier National Monumentlocation not on record | 3 |
| INFlocation not on record | 3 |
| Frankfurt am Main | 3 |
| WINlocation not on record | 3 |
| Mount Berry, US | 3 |
| Valparaiso, CL | 3 |
| Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record | 3 |
| Edinburgh, GB | 3 |
| Zürich, CH | 3 |
| Ivano-Frankivsk, UA | 3 |
| Meguro Parasitological Museumlocation not on record | 3 |
| Pontifícia Universidade Católica do Paranálocation not on record | 3 |
| TAFORI-LSRClocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Chicago, US | 3 |
| Jefferson City, US | 3 |
| Uberlândia, BR | 3 |
| Conway, US | 3 |
| Sevilla, ES | 3 |
| San Jose, US | 3 |
| Ensenada, MX | 3 |
| Lake Charles, US | 3 |
| Tuxtla Gutiérrez, MX | 3 |
| Provincia di Livornolocation not on record | 3 |
| University of Tennessee at Chattanoogalocation not on record | 3 |
| University of North Carolina at Pembrokelocation not on record | 3 |
| Catalina Island Conservancylocation not on record | 3 |
| Autlán de Navarro, MX | 3 |
| Ypsilanti, US | 3 |
| Northridge, US | 3 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 3 |
| Davenport, US | 2 |
| Morelia, MX | 2 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 2 |
| Instituto de Investigaciones Botánicas y Zoológicas - Prof. Rafael M. Moscoso, Universidad Autónoma de Santo Domingolocation not on record | 2 |
| Institute of the biological problems of the North FEB RASlocation not on record | 2 |
| Castelar, AR | 2 |
| KNFHClocation not on record | 2 |
| Macomb, US | 2 |
| Zhengzhou, CN | 2 |
| Giardini Botanici Hanburylocation not on record | 2 |
| INBIOlocation not on record | 2 |
| UNICAMPlocation not on record | 2 |
| Trois-Rivières, CA | 2 |
| Loja, EC | 2 |
| Shanxi Universitylocation not on record | 2 |
| SEFlocation not on record | 2 |
| Hermosillo, MX | 2 |
| Philadelphia, US | 2 |
| Little Rock, US | 2 |
| FUVATESlocation not on record | 2 |
| UnBlocation not on record | 2 |
| Foz do Iguaçu, BR | 2 |
| Dehra Dun, IN | 2 |
| Universidad de Nariño (UdeNar)location not on record | 2 |
| Linares, MX | 2 |
| MMHNSRlocation not on record | 2 |
| Chengdu, CN | 2 |
| Xinxiang, CN | 2 |
| UFABClocation not on record | 2 |
| Herbarium of South China Botanical Gardenlocation not on record | 2 |
| Stephenville, US | 2 |
| Yellowstone National Park Herbariumlocation not on record | 2 |
| UDESC-CAVlocation not on record | 2 |
| HJAEFlocation not on record | 2 |
| UFSMlocation not on record | 2 |
| Sion, CH | 2 |
| Bergen, NO | 2 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 2 |
| Harrisonburg, US | 2 |
| Kagoshima, JP | 2 |
| Universiti Sains Malaysialocation not on record | 2 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 2 |
| Yaoundé, CM | 2 |
| University of Johannesburglocation not on record | 2 |
| Tennessee Technological Universitylocation not on record | 2 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 2 |
| UEMlocation not on record | 2 |
| Oswego, US | 2 |
| Cambridge, US | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| Elocation not on record | 1 |
| Mexico City, MX | 1 |
| Coimbra, PT | 1 |
| UFOPlocation not on record | 1 |
| San José, CR | 1 |
| arosemena tola, EC | 1 |
| Bothell, US | 1 |
| Herbario de la Universidad Técnica del Nortelocation not on record | 1 |
| Cenargenlocation not on record | 1 |
| CUVClocation not on record | 1 |
| Sapporo, JP | 1 |
| Royal British Columbia Museumlocation not on record | 1 |
| Viña del Mar, CL | 1 |
| Universidade Federal do Espírito Santolocation not on record | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| The University of Arizonalocation not on record | 1 |
| OLAlocation not on record | 1 |
| Balochistan University of Information Technology, Engineering and Management Scienceslocation not on record | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| Yukon Universitylocation not on record | 1 |
| Chongqing Natural History Museumlocation not on record | 1 |
| National Museums of Kenyalocation not on record | 1 |
| Universidad Icesi (ICESI)location not on record | 1 |
| Post Graduate College Bannulocation not on record | 1 |
| Asheville, US | 1 |
| Universidad Católica de Oriente (UCO)location not on record | 1 |
| JBSlocation not on record | 1 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 1 |
| Gifu prefectural Museumlocation not on record | 1 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 1 |
| Wuhan, CN | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| Badajoz, ES | 1 |
| Quito, EC | 1 |
| DNSMlocation not on record | 1 |
| Durham, US | 1 |
| Canadian Museum of Naturelocation not on record | 1 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 1 |
| Universidad Nacional de Asunciónlocation not on record | 1 |
| Monastir, TN | 1 |
| 河南豫北黄河故道湿地鸟类国家级自然保护区location not on record | 1 |
| Royal Alberta Museumlocation not on record | 1 |
| Kunming, CN | 1 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 1 |
| Jurica-Suchy Nature Museumlocation not on record | 1 |
| León, NI | 1 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 1 |
| Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record | 1 |
| UTFPR-DVlocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Herbario UTCEClocation not on record | 1 |
| Toluca, MX | 1 |
| San Francisco, US | 1 |
| Hamilton, US | 1 |
| Mount Pleasant, US | 1 |
| VALElocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| LPMMBHlocation not on record | 1 |
| Cascavel, BR | 1 |
| ROM020location not on record | 1 |
| Mérida, MX | 1 |
| JBRJlocation not on record | 1 |
| Firenze, IT | 1 |
| Omachi Alpine Museumlocation not on record | 1 |
| Instituto de Ecología, Universidad Nacional Autónoma de Méxicolocation not on record | 1 |
| Arequipa, PE | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| Fargo, US | 1 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 1 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 1 |
| Ivano-Frankove, UA | 1 |
| University of Genevalocation not on record | 1 |
| San Bernardino, US | 1 |
| Bureau of Land Managementlocation not on record | 1 |
| University of Lethbridgelocation not on record | 1 |
| Smithsonian Institutionlocation not on record | 1 |
| National Institute for Agricultural and Veterinarian Research, Portugallocation not on record | 1 |
| Kathmandu, NP | 1 |
| HUAlocation not on record | 1 |
| Tapachula, MX | 1 |
| Portland, US | 1 |
| SJNAlocation not on record | 1 |
| US | 1 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 1 |
| Brasília, BR | 1 |
| UFRRJlocation not on record | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Kingston, US | 1 |
| Conway, US | 1 |
| CEPLAClocation not on record | 1 |
| UFBAlocation not on record | 1 |
| Mazatlán, MX | 1 |
| Samara National Research Universitylocation not on record | 1 |
| La Paz, MX | 1 |
| US | 1 |
| CPATSAlocation not on record | 1 |
| Decorah, US | 1 |
486 institutions · 26 627 of 28 246 vouchered records shown · 1 190 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA57 detections
Where the DNA of Taraxacum officinale was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found57
Studies independent surveys2
Countries12
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 57 detections have coordinates
Open the map12 countries0
Disclimax Diegan Scrub: Grasses; Lamarkia au…Xeric sagebrush steppe
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.4 °C 0.7–18.8
Seasonal swing summer↔winter21.6 °C
Max temp (day)16.0 °C 2.90–24.4
Min temp (night)8.70 °C -2.90–13.3
Precipitation71.3 mm/mo 43.4–110
Air humidity58.7 % 52.5–65.3
Moisture balance-22.9 mm/mo -74.0–108
Vapour deficit569 Pa 234–1,006
Wind speed2.80 m/s 2.00–6.60
Cloud cover40.9 % 34.0–50.8
CHELSA 1981–2010, ~9 km grid, at location & month of 36 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.