Taraxacum formosanum

Kitam. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Taraxacum

At a glance

Occurrence records306

Data sources8

Biological traits0

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Taraxacum formosanum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility306 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS65 compounds

Occurrence & distributionGBIF306 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 16

01Narrative

台湾蒲公英（学名：）为菊科蒲公英属下的一个种。

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition65 compounds

Compounds documented for Taraxacum formosanum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cinnamic acids and derivatives13

Simple phenolic acids11

Carboline alkaloids6

Cinnamic acids and derivatives $ Simple phenolic acids4

Simple indole alkaloids4

Documented compounds65 total

Tissue Source Quantified only

Compound	Amount	Source
(2R)-2-[(E)-3-(3,4-dihydroxyphenyl)prop-2-enoyl]oxy-2-hydroxyacetic acid	present	LOTUS
(2R)-2-azaniumyl-3-phenylpropanoate	present	LOTUS
(2R,3R,4S,5S,6S)-2-[[(3S,8S,9S,10R,13R,14S,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2S)-2-(phenylazaniumyl)propanoate	present	LOTUS
(3R,3aR,4R,9aS,9bR)-3-hydroxy-3,6,9-trimethyl-4-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4,5,9a,9b-tetrahydro-3aH-azuleno[4,5-b]furan-2,7-dione	present	LOTUS
(3S)-2,3,4,9-tetrahydro-1H-carbazole-3-carboxylic acid	present	LOTUS
(3S)-2,3,4,9-tetrahydro-1H-pyrido[3,4-b]indol-2-ium-3-carboxylate	present	LOTUS
(3S)-3-hydroxycyclocitral	present	LOTUS
(3S,4aR,6aR,6bR,8aS,12S,12aR,12bR,14aR,14bR)-4,4,6a,6b,8a,11,12,14b-octamethyl-1,2,3,4,4a,5,6,6a,6b,7,8,8a,9,12,12a,12b,13,14,14a,14b-icosahydropicen-3-yl acetate	present	LOTUS
(3S,8S,9S,10R,13R,14S,17R)-17-((E,2S,5S)-5-Ethyl-6-methylhept-3-en-2-yl)-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta(a)phenanthren-3-ol	present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Taraxacum formosanum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY862577.1 ↗643 bpTaiwan

ACGT

TCGAACCCTGCAAGGCAGAACGACCCGTGAACACGTAAATACAACCGGGTGATGGGGAGATGGATCTTGGTTTTGATCCTCAGCACCTTC …

Taraxacum formosanum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Taraxacum formosanum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidypolyploid inferred

Chromosome records16–162n range16median16mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 163×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl — Peng, C. i. & C. c. Hsu. 1978. Chromosome numbers in Taiwan Compositae. Bot. Bull. Acad. Sin. 19: 53–66.

CCDB · ipcn-api-dl — Peng, C. i. & C. c. Hsu. 1977. In IOPB chromosome number reports LVIII. Taxon 26: 557–565.

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type306 records

Wild obs. + sensor253

Museum / vouchered53

Origin

Native7

Range

Area of Occupancy AOO892 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy1% within 1 km

≤100 m 2>10 km 250

252 georeferenced · 1 without coordinates

Open the mapobservation + sensor253

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 4≤1 km 3

7 georeferenced · 46 without coordinates

Open the institutions mapphysical evidence53

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Taipei, TW	26
TAIElocation not on record	7
National Museum of Natural Sciencelocation not on record	7
Taipei, TW	5
Taipei, TW	4
Institute of Applied Ecology, Academia Sinicalocation not on record	3
University of Stellenboschlocation not on record	1

7 institutions · 53 of 53 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)