Taraxacum coreanum

Nakai · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Taraxacum

At a glance

Occurrence records900

Data sources10

Biological traits9

DNA specimens13

eDNA detections12

Sources10 archives

Databases and archives Taraxacum coreanum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility900 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources9 traits

Chemical compositionLOTUS · NPASS142 compounds

Occurrence & distributionGBIF900 records

Environmental DNA1 datasets · 1 countries12 detections

DNA & barcodingBOLD · NCBI13 specimens

Genome at a glanceCCDB2n = 32

01Narrative

ケイリンシロタンポポは、キク科タンポポ属の1種である。

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction4

Flowering endJun

Flowering startMay

Life formperennial

Life spanperennial

Habitat & environment5

Climatetemperate

Climberself-supporting

Growth formherb

Habitat GIFTmeadows, roadsides

Woodinessnon-woody

03Chemical composition142 compounds

Compounds documented for Taraxacum coreanum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cinnamic acids and derivatives24

Unsaturated fatty acids10

Flavonols9

Flavones8

Cembrane diterpenoids7

Documented compounds142 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Chicoricacid	present	NPASS
(+)-Valine	present	NPASS
(-)-Carnitine	present	NPASS
(-)-Chicoric acid	present	NPASS
(2E,7R,11R)-2-Phyten-1-ol	present	NPASS
(3S,5S,7R,10E)-3,10-dimethyl-7-prop-1-en-2-yl-4,16-dioxatricyclo[12.2.1.03,5]heptadeca-1(17),10,14-triene	present	NPASS
(4S,6S,9S,11E)-6,12-dimethyl-9-prop-1-en-2-yl-5,15-dioxatricyclo[12.2.1.04,6]heptadeca-1(16),11,14(17)-triene	present	NPASS
(Z,Z)-9,12-Octadecadienoic acid	present	NPASS
(±)-Alanine	present	NPASS
17-(5-ethyl-6-methylhept-3-en-2-yl)-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	LOTUS

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Taraxacum coreanum has left across the world's sequence archives.

At a glance

DNA specimens13

Marker genes3

GenBank sequences10

eDNA detections12

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMT077855.1 ↗6 911 bpSouth Korea

ACGT

TACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACAAATTCAGACTGTGAAACTG …

Taraxacum coreanum voucher IM150601_7_type2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL8★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Taraxacum coreanum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidypolyploid inferred

Chromosome records24–322n range32median32mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 324×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74 +1

CCDB · ipcn-api-dl — Probatova, N. S., A. P. Sokolovskaja & E. G. Rudyka. 1991. Chromosome numbers in some species of vascular plants from the Soviet Far East and other regions of the USSR. Bot. Žhurn. (Moscow & Leningrad) 76: 1174–1178.

CCDB · book-ipcn67-71 — LEE, Y.N. 1970. Chromosome number of flowering plants in Korea (3) J. Korean Res. Inst. Better Living 5: 127-129.

CCDB · book-ipcn73-74 — LEE, Y.N., & Y.C. OH. 1970. Taxonomic study on genus Taraxacum in South Korea. J. Korean Res. Inst. Better Living 4: 63 68.

CCDB · eflora

2n 241×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Probatova. 2004. Chromosome numbers of some representatives of the flora of the Primorsky Territory. Bot. Žhurn. (Moscow & Leningrad) 89(7): 1209–1217.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type900 records

Wild obs. + sensor795

Museum / vouchered105

Range

Area of Occupancy AOO2 652 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 54≤1 km 11≤10 km 8>10 km 17

90 georeferenced · 705 without coordinates

Open the mapobservation + sensor795

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤1 km 3≤10 km 11>10 km 1

15 georeferenced · 90 without coordinates

Open the institutions mapphysical evidence105

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Institute of Biological Resourceslocation not on record	21
NSMKlocation not on record	20
KR	14
Kyoto Universitylocation not on record	12
Herbarium of the Department of Botany, University of Tokyolocation not on record	11
Institute of Applied Ecology, Academia Sinicalocation not on record	8
KIWElocation not on record	6
Korea National Arboretumlocation not on record	4
Tsukuba, JP	2
Guilin, CN	2
DMZ botanic gardenlocation not on record	1
Beijing, CN	1
Balochistan University of Information Technology, Engineering and Management Scienceslocation not on record	1

13 institutions · 103 of 105 vouchered records shown · 2 without an institution code

09Environmental DNA12 detections

Where the DNA of Taraxacum coreanum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.8 °C 13.8–13.8

Seasonal swing summer↔winter23.2 °C

Max temp (day)17.9 °C

Min temp (night)7.60 °C

Precipitation48.2 mm/mo

Air humidity43.6 %

Moisture balance-93.9 mm/mo

Vapour deficit904 Pa

Wind speed3.40 m/s

Cloud cover35.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)