Taraxacum carneocoloratum

A.Nelson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Taraxacum

At a glance

Occurrence records27

Data sources9

Biological traits9

DNA specimens6

eDNA detections3

Sources9 archives

Databases and archives Taraxacum carneocoloratum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility27 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF27 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 32

01Narrative

Taraxacum carneocoloratum, également connu sous le nom de pissenlit rose ou de pissenlit charnu, est une espèce de pissenlit vivace endémique du Yukon et de l'Alaska, que l'on ne trouve que dans les zones non glacées de l'ouest du Yukon, en particulier à North Fork Pass dans les monts Ogilvie et dans le parc national Ivvavik. L'espèce se caractérise par l'absence de cornes ou de tubercules à l'extrémité des bractées involucrales, une hauteur typiquement petite de moins de 9 cm, des pétales roses à couleur chair et un pappus jaunâtre. Elle fleurit entre juin et août.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Taraxacum carneocoloratum has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes5

GenBank sequences4

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG218074.1 ↗456 bpCanada · 2008

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAAGCCATCCGGTTGAGGGCACGCCTGCCTGGGCGTCACGCATC …

Taraxacum carneocoloratum voucher CCDB-18324-H7 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLa★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Taraxacum carneocoloratum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 321×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — MULLIGAN, G.A., & A.E. PORSILD. 1970. In IOPB chromosome number reports XXV. Taxon 19: 102-113:-

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type27 records

Wild obs. + sensor15

Museum / vouchered12

Range

Area of Occupancy AOO84 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy15% within 1 km

≤100 m 2≤10 km 7>10 km 4

13 georeferenced · 2 without coordinates

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Yukon Universitylocation not on record	3
Whitehorse, CA	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Research Collection of B. A. Bennettlocation not on record	1
Canadian Museum of Naturelocation not on record	1
Montréal, CA	1
Anchorage, US	1
B.A. Bennett Herbariumlocation not on record	1

8 institutions · 10 of 12 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Taraxacum carneocoloratum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

Alpine base of rock outcrops with Chamaeneri…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.1 °C 10.4–11.1

Seasonal swing summer↔winter36.3 °C

Max temp (day)15.2 °C 14.0–15.2

Min temp (night)7.40 °C 6.60–7.40

Precipitation111 mm/mo 111–122

Air humidity61.8 % 61.1–61.8

Moisture balance5.50 mm/mo 5.50–21.1

Vapour deficit505 Pa 492–505

Wind speed3.30 m/s 3.30–3.60

Cloud cover73.8 % 58.7–73.8

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)