Taraxacum aphrogenes — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Taraxacum

At a glance

Occurrence records51

Data sources5

Biological traits2

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Taraxacum aphrogenes's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility51 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF51 records

DNA & barcodingNCBIsequences

01Narrative

Taraxacum aphrogenes, the Paphos dandelion, is a perennial, lactiferous, rosulate, hairless herb, up to 12 cm high. Leaves all in rosette, simple, divided almost to midrib, into unequal, bluntish, suborbicular lobes, fleshy, oblong, 3-8 x 0.3-2 cm. Flowers in capitula, with yellow, ligulate florets. Flowers October–December in advance of the leaves. Fruit a pappose achene.The Endemic Plants of Cyprus, Texts: Takis Ch. Tsintides, Photographs: Laizos Kourtellarides, Cyprus Association of Professional Foresters, Bank of Cyprus Group, Nicosia 1998,

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVP

Life cycle & reproduction1

Life formperennial

Habitat & environment1

Climatetemperate

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Taraxacum aphrogenes has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKF437446.1 ↗511 bpCyprus · 1994

ACGT

GGCTATCATGCATGTACTGTTGGACTTTAACAAAACCCCGGCACGGCATGTGCCAAGGAAAACAGTAAATAGAAGGACTTGACCTGTTAT …

Taraxacum aphrogenes voucher Meyer no. 132 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type51 records

Wild obs. + sensor50

Museum / vouchered1

Range

Area of Occupancy AOO68 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 26≤1 km 6

32 georeferenced · 18 without coordinates

Open the mapobservation + sensor50

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.