Taprobanea spathulata

(L.) Christenson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Taprobanea

At a glance

Occurrence records20

Data sources7

Biological traits9

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Taprobanea spathulata's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility20 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF20 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 114

01Narrative

Taprobanea is a genus of flowering plants from the orchid family, Orchidaceae. There is only one known species, Taprobanea spathulata, native to India and to Sri Lanka.Kew World Checklist of Selected Plant FamiliesChristenson, Eric Alston. 1992. Lindleyana 7: 90-91

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formclimbing epiphyte

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteobligatory

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Herb (H)

Woodinesswoody

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Taprobanea spathulata has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLOK424856.1 ↗688 bpIndia

ACGT

TTTATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAATAT …

Vanda spathulata ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Taprobanea spathulata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 114 n = 57

Ploidypolyploid inferred

Chromosome records76–1142n range114median114mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1143×CCDB · ipcn-api-dl · CCDB · book-indian_vol2 · CCDB · Cave1963

CCDB · ipcn-api-dl — Vatsala, P., G. Radhamoni & C. A. Ninan. 1985. Chromosome number in Vanda spathulata Spreng. New Bot. 12: 169–171.

CCDB · book-indian_vol2 — Kamemoto, H., Tanaka, R. & Kosaki, K. 1961

CCDB · Cave1963 — Storey, Kam. & s. 1963

2n 761×CCDB · book-indian_vol2

CCDB · book-indian_vol2 — Storey, W.B. 1952

n 381×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Vatsala, P., G. Radhamoni & C. A. Ninan. 1985. Chromosome number in Vanda spathulata Spreng. New Bot. 12: 169–171.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type20 records

Wild obs. + sensor10

Museum / vouchered10

Range

Area of Occupancy AOO64 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 10

10 georeferenced

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 10 records without

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	3
Pondicherry, IN	3

2 institutions · 6 of 10 vouchered records shown · 4 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)