Taphrina wiesneri

(Ráthay) Mix · species

image placeholder — illustration coming later

Fungi/Ascomycota/Taphrinomycetes/Taphrinales/Taphrinaceae/Taphrina

At a glance

Occurrence records620

Data sources10

Biological traits0

DNA specimens8

eDNA detections52

Sources10 archives

Databases and archives Taphrina wiesneri's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility620 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI52 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF620 records

Environmental DNA5 datasets · 10 countries52 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceGoaT · NCBI≈13 Mbp

01Narrative

Taphrina wiesneri is a plant pathogen causing witch's broom, or plant gall formations, on cherry trees (Prunus & Cerasus spp). It is an important pest species of the ornamental cherry Cerasus X yedoensis in Japan.Komatsu, M., Taniguchi, M., Matsushita, N., Takahashi, Y., & Hogetsu, T., (2010) Overwintering of Taphrina wiesneri within cherry shoots monitored with species-specific PCR. J Gen Plant Pathol Vol. 76, pp. 363–369

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Taphrina wiesneri has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes3

GenBank sequences10

eDNA detections52

Countries10

The DNA barcodea real sequence read deposited for this species

ITSKU134842.1 ↗574 bp

ACGT

AGTCTGGGTCTAAAAACCCTCTCTCTTCTACACACTTGTGAACTTACACTGTTGCTTTGGCAGGTTTCCAGATGGGTTCTCTGAACCCGG …

Taphrina wiesneri strain TW001 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10★ITS1

animal barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Taphrina wiesneri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈13 098 230 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Taphrina wiesneri0.01 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness82.9% BUSCO

08Occurrence & distribution

Record type620 records

Wild obs. + sensor430

Museum / vouchered185

Cultivated / captive2

Other3

Range

Area of Occupancy AOO1 368 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 364≤1 km 34≤10 km 27

425 georeferenced · 5 without coordinates

Open the mapobservation + sensor430

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 3≤1 km 43≤10 km 6>10 km 4

56 georeferenced · 129 without coordinates

Open the institutions mapphysical evidence185

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	43
Bronx, US	39
Auckland, NZ	11
DPIlocation not on record	10
Kew, GB	4
Champaign, US	4
Bernard Price Institute for Palaeontological Researchlocation not on record	4
Odawara, JP	3
Tartu, EE	3
Helsinki, FI	3
Hirosaki Universitylocation not on record	2
Bando, JP	2
SLU Artdatabankenlocation not on record	2
Museo Entomologico de Leonlocation not on record	1
Görlitz, DE	1
Norwegian Institute of Bioeconomy Researchlocation not on record	1
Karlsruhe, DE	1
Uppsala, SE	1

18 institutions · 135 of 185 vouchered records shown · 48 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA52 detections

Where the DNA of Taphrina wiesneri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found52

Studies independent surveys5

Countries10

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 52 detections have coordinates

Open the map10 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 6.00–24.4

Seasonal swing summer↔winter16.7 °C

Max temp (day)20.2 °C 9.40–27.4

Min temp (night)11.7 °C 1.70–20.5

Precipitation120 mm/mo 64.6–268

Air humidity61.8 % 57.8–66.4

Moisture balance53.5 mm/mo -34.0–141

Vapour deficit725 Pa 389–1,020

Wind speed2.90 m/s 1.20–3.50

Cloud cover39.0 % 34.4–46.4

CHELSA 1981–2010, ~9 km grid, at location & month of 45 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)